ID: 1137748536

View in Genome Browser
Species Human (GRCh38)
Location 16:50841431-50841453
Sequence TTTGTTTTCAAAATGACACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137748531_1137748536 16 Left 1137748531 16:50841392-50841414 CCTCCGCTGTAGCAATTCCGAGG No data
Right 1137748536 16:50841431-50841453 TTTGTTTTCAAAATGACACGCGG No data
1137748529_1137748536 28 Left 1137748529 16:50841380-50841402 CCGTGGGGGCCGCCTCCGCTGTA No data
Right 1137748536 16:50841431-50841453 TTTGTTTTCAAAATGACACGCGG No data
1137748530_1137748536 19 Left 1137748530 16:50841389-50841411 CCGCCTCCGCTGTAGCAATTCCG No data
Right 1137748536 16:50841431-50841453 TTTGTTTTCAAAATGACACGCGG No data
1137748535_1137748536 -1 Left 1137748535 16:50841409-50841431 CCGAGGGTAAAATTGATTAATAT No data
Right 1137748536 16:50841431-50841453 TTTGTTTTCAAAATGACACGCGG No data
1137748534_1137748536 13 Left 1137748534 16:50841395-50841417 CCGCTGTAGCAATTCCGAGGGTA No data
Right 1137748536 16:50841431-50841453 TTTGTTTTCAAAATGACACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137748536 Original CRISPR TTTGTTTTCAAAATGACACG CGG Intergenic