ID: 1137748734 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:50842399-50842421 |
Sequence | GGCCTGACTCCTGTTTCTAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1137748734_1137748737 | 9 | Left | 1137748734 | 16:50842399-50842421 | CCTTTAGAAACAGGAGTCAGGCC | No data | ||
Right | 1137748737 | 16:50842431-50842453 | TTCCGCTCAAAACTCTTCCCTGG | No data | ||||
1137748734_1137748741 | 27 | Left | 1137748734 | 16:50842399-50842421 | CCTTTAGAAACAGGAGTCAGGCC | No data | ||
Right | 1137748741 | 16:50842449-50842471 | CCTGGCTTCCTCTTTCTCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1137748734 | Original CRISPR | GGCCTGACTCCTGTTTCTAA AGG (reversed) | Intergenic | ||