ID: 1137748734

View in Genome Browser
Species Human (GRCh38)
Location 16:50842399-50842421
Sequence GGCCTGACTCCTGTTTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137748734_1137748737 9 Left 1137748734 16:50842399-50842421 CCTTTAGAAACAGGAGTCAGGCC No data
Right 1137748737 16:50842431-50842453 TTCCGCTCAAAACTCTTCCCTGG No data
1137748734_1137748741 27 Left 1137748734 16:50842399-50842421 CCTTTAGAAACAGGAGTCAGGCC No data
Right 1137748741 16:50842449-50842471 CCTGGCTTCCTCTTTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137748734 Original CRISPR GGCCTGACTCCTGTTTCTAA AGG (reversed) Intergenic