ID: 1137750516

View in Genome Browser
Species Human (GRCh38)
Location 16:50858097-50858119
Sequence TGGGTCAGTGGTGGTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137750504_1137750516 16 Left 1137750504 16:50858058-50858080 CCCCACACTGGAGCCAGGCTTTG No data
Right 1137750516 16:50858097-50858119 TGGGTCAGTGGTGGTGGGAAGGG No data
1137750505_1137750516 15 Left 1137750505 16:50858059-50858081 CCCACACTGGAGCCAGGCTTTGA No data
Right 1137750516 16:50858097-50858119 TGGGTCAGTGGTGGTGGGAAGGG No data
1137750506_1137750516 14 Left 1137750506 16:50858060-50858082 CCACACTGGAGCCAGGCTTTGAA No data
Right 1137750516 16:50858097-50858119 TGGGTCAGTGGTGGTGGGAAGGG No data
1137750508_1137750516 3 Left 1137750508 16:50858071-50858093 CCAGGCTTTGAAGGACAGATCAA No data
Right 1137750516 16:50858097-50858119 TGGGTCAGTGGTGGTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137750516 Original CRISPR TGGGTCAGTGGTGGTGGGAA GGG Intergenic