ID: 1137753276

View in Genome Browser
Species Human (GRCh38)
Location 16:50882168-50882190
Sequence GAGAGGCCACACACGCACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137753276 Original CRISPR GAGAGGCCACACACGCACAG CGG (reversed) Intergenic
900169557 1:1259921-1259943 GGGAGGCCACACATGCAGGGAGG - Intronic
900295274 1:1946131-1946153 GAGTGTGCACACACGCACACTGG - Intronic
900574115 1:3374581-3374603 GAAAGGCCACAGTCGCACAGAGG - Intronic
900822627 1:4900967-4900989 GGGAGGCCTCACAGTCACAGTGG + Intergenic
900872183 1:5312006-5312028 CAGAGGCCAGACTCCCACAGAGG + Intergenic
901040363 1:6359648-6359670 AAGAGGCCAAACAATCACAGCGG + Intronic
901305918 1:8232610-8232632 GACAGCGCACACACACACAGAGG - Intergenic
901351716 1:8602985-8603007 AAGAGGACAGACACGTACAGAGG + Intronic
901456596 1:9366552-9366574 CTGAGGACACACAGGCACAGAGG - Intronic
901693520 1:10989947-10989969 GGGAGGCCTCACAATCACAGTGG + Intergenic
902153343 1:14462655-14462677 GAGAGGCCTCACACTCATGGTGG + Intergenic
902749480 1:18497511-18497533 GGGAGGCCTCAGACTCACAGCGG + Intergenic
903018736 1:20378988-20379010 GAGAGGCCTCACAATCACCGTGG + Intergenic
903282356 1:22257276-22257298 GGGAGGACACAGAGGCACAGGGG + Intergenic
903667002 1:25014162-25014184 GAGAGGCCACAGATGCCAAGAGG + Intergenic
904734675 1:32622125-32622147 GAGAGGCAACACATGCACAATGG + Intronic
905939551 1:41852335-41852357 GAGAGGCCACAGAGGGACACAGG + Intronic
909694710 1:78453858-78453880 GGGAGGCCTCACAATCACAGTGG - Intronic
910287091 1:85567504-85567526 AAGAGGCCTCACAATCACAGTGG - Intronic
911483395 1:98474152-98474174 GAGTGGCCAAACAACCACAGGGG - Intergenic
912004474 1:104879496-104879518 GAGAGGCCTCACAATCACGGTGG - Intergenic
921540725 1:216411495-216411517 GAGAAGACACACACGATCAGAGG + Intronic
922426115 1:225496279-225496301 GAGAGCACACACACGCAGAGTGG + Exonic
923574159 1:235142641-235142663 GAGCCACCACACACGCCCAGAGG - Intronic
1062841029 10:672095-672117 AACAGGCCACAGACGCACGGAGG + Intronic
1062958161 10:1553815-1553837 CAGAGGCCACACCCGCACACGGG + Intronic
1063665435 10:8057986-8058008 GAGAGGCCAAATAAGCAAAGGGG + Intronic
1064140811 10:12788609-12788631 CAGTGGCCAAACAGGCACAGAGG - Intronic
1065135887 10:22669647-22669669 GAGAGGCCATGCACACTCAGAGG + Intronic
1065947807 10:30623422-30623444 GTGAGGCCACAGACACACATAGG - Intronic
1069055460 10:63839990-63840012 GGGAGGCCTCACAATCACAGTGG - Intergenic
1070385101 10:75917231-75917253 GAGAGGCCACACATACACTGGGG - Intronic
1070629007 10:78071055-78071077 GAGAGTCCACAGGGGCACAGGGG - Intergenic
1070900211 10:80022140-80022162 GAGAGGCCACACATACACCATGG + Intergenic
1071342821 10:84664369-84664391 GAGAAGCCACAGACCCACAGGGG + Intergenic
1073971876 10:109052951-109052973 GGGAGGCCTCACAATCACAGCGG - Intergenic
1074861852 10:117516227-117516249 GAGAGGCCTCACAATCACGGCGG + Intergenic
1075352655 10:121737950-121737972 GAGATGCTACAAACGCACATAGG + Intergenic
1076378735 10:130010799-130010821 GAGAGGACACACAGGGACATGGG + Intergenic
1076528733 10:131130134-131130156 GGGAGGCCTCACAATCACAGTGG + Intronic
1077412652 11:2410759-2410781 GGCAGGCCACACACACACATTGG + Intronic
1079968570 11:27008043-27008065 GAGAGGCCAAACAGGCAATGGGG - Intergenic
1080074597 11:28134381-28134403 AAGAGCCCACATACGCACGGGGG - Intronic
1083398996 11:62411134-62411156 GAGAGGGCAGACAGGCACGGAGG + Intronic
1083614140 11:64018199-64018221 CCCAGGCCACCCACGCACAGTGG + Intronic
1083962999 11:66024878-66024900 GGCAGGCCACACACCCACATTGG + Intronic
1084332200 11:68436859-68436881 GAGAGGCCATGCACTCAGAGAGG - Intronic
1085177852 11:74506618-74506640 GAGAGGCCCAACAGGCACATGGG - Intronic
1085387310 11:76164529-76164551 CAGAGGGGACACACGCACGGGGG + Intergenic
1085387334 11:76164656-76164678 AGGAAGCGACACACGCACAGAGG + Intergenic
1085387339 11:76164673-76164695 CAGAGGGGACACACGCACAGGGG + Intergenic
1085387352 11:76164737-76164759 AGGAAGCGACACACGCACAGAGG + Intergenic
1085387357 11:76164754-76164776 CAGAGGGGACATACGCACAGGGG + Intergenic
1085387362 11:76164771-76164793 CAGGGGGGACACACGCACAGGGG + Intergenic
1085387375 11:76164835-76164857 AGGAAGCGACACACGCACAGAGG + Intergenic
1085387380 11:76164852-76164874 CAGAGGGGACATACGCACAGGGG + Intergenic
1085387384 11:76164869-76164891 CAGGGGGCACACACGCACAGGGG + Intergenic
1085387397 11:76164933-76164955 AGGAAGCGACACACGCACAGAGG + Intergenic
1085387402 11:76164950-76164972 CAGAGGGGACACACGCACAGGGG + Intergenic
1085394682 11:76201295-76201317 GGGAGGCCACCCGCCCACAGGGG + Intronic
1087554172 11:99693524-99693546 CAGAGGGCACACAGGCCCAGTGG + Intronic
1089458445 11:118639191-118639213 GAGATACCACTCACTCACAGGGG + Exonic
1090922230 11:131216405-131216427 GAGAAGCCACACAGAGACAGAGG - Intergenic
1091630343 12:2155124-2155146 GAGGCGTCACACACACACAGAGG + Intronic
1092593544 12:9975055-9975077 GAGAGGCCTCACACTCATGGTGG - Intronic
1093753566 12:22828795-22828817 GAGAGGCCACACAATCATGGCGG - Intergenic
1096472755 12:51889478-51889500 GGGTGGCCACGCACTCACAGCGG - Exonic
1104137430 12:125953869-125953891 GGGAGGCCTCACAATCACAGTGG + Intergenic
1105576339 13:21656588-21656610 GAGAGGCCTCACAATCACGGTGG + Intergenic
1109160642 13:58969484-58969506 GGGAGGCCTCACAATCACAGTGG - Intergenic
1112275778 13:98017677-98017699 CTGAGGCCATGCACGCACAGGGG - Intronic
1113448970 13:110392512-110392534 GAGTGGACACACAGGCAGAGGGG - Intronic
1113959137 13:114116094-114116116 GAGAGGGCACAGGCCCACAGGGG - Intronic
1117871943 14:60210450-60210472 GGGAGGCCTCACAATCACAGTGG + Intergenic
1118720677 14:68591614-68591636 CACCGGCCACACACACACAGGGG - Intronic
1119546048 14:75472172-75472194 TTGAGGTCACACATGCACAGTGG - Intronic
1121536318 14:94693479-94693501 GAGAGGCCACACAATCATGGTGG - Intergenic
1123075913 14:105667323-105667345 CAGCCGCCACACACACACAGGGG - Intergenic
1123090614 14:105740552-105740574 CAGCCGCCACACACACACAGGGG - Intergenic
1126918973 15:53499145-53499167 GTGAGGCCTCACAATCACAGTGG + Intergenic
1127101630 15:55571641-55571663 GAGAGGCCCCACAATCACGGTGG - Intronic
1127127939 15:55831442-55831464 GAGAGGCCAGAGACGGAAAGGGG + Intronic
1128718480 15:69927927-69927949 GAGAGGCCTCACAATCATAGTGG + Intergenic
1129908229 15:79204911-79204933 GAGATGCCACAGACCCACATTGG - Intergenic
1130955716 15:88626118-88626140 GAGAGAACACACAGGCAGAGGGG - Intronic
1131936864 15:97515908-97515930 GTCACGCCACACACACACAGAGG + Intergenic
1132693165 16:1190685-1190707 GAGCTGCCCCACAGGCACAGGGG + Intronic
1132974574 16:2704996-2705018 GAGGGGACACACAGGCTCAGGGG - Intronic
1134463174 16:14447849-14447871 GAGAGGCCATTCAAGCACATGGG + Intronic
1135538076 16:23309877-23309899 GAGAAGGCCCACAGGCACAGAGG - Intronic
1136674631 16:31892155-31892177 GGGAGGCCTCACAATCACAGTGG + Intronic
1137753276 16:50882168-50882190 GAGAGGCCACACACGCACAGCGG - Intergenic
1137926964 16:52548683-52548705 GAAAGGCCACAGGCGCCCAGTGG - Intergenic
1138805848 16:60087345-60087367 GGGAGGCCTCACAATCACAGTGG + Intergenic
1140948288 16:79791747-79791769 GAGAAGAGACACACACACAGAGG - Intergenic
1143186793 17:5014857-5014879 GAGAGGCCAGACAGGGAGAGAGG + Intronic
1143331696 17:6141495-6141517 GAGAGACCACACAAGCTAAGCGG - Intergenic
1143590321 17:7882232-7882254 GAGAGGGCACAGAGGCAGAGAGG + Intronic
1144688951 17:17246610-17246632 GAAAGGCCAGACAGACACAGTGG - Intergenic
1145836228 17:27956338-27956360 GCGAGGCCACAGCCACACAGAGG + Intergenic
1146057936 17:29590271-29590293 GTGAGTGCACACAGGCACAGTGG - Intronic
1147179269 17:38674365-38674387 GCGAGGGCACGCAGGCACAGCGG + Exonic
1147313490 17:39607897-39607919 GAGATGCCACACTCGCTCCGCGG - Exonic
1148145715 17:45363539-45363561 AAGAGGAGACACAGGCACAGAGG - Intergenic
1148789306 17:50164467-50164489 GAGAGGTCACACAGGCACCAAGG + Intronic
1148800833 17:50224725-50224747 GGGAGGCCTCACAGTCACAGAGG + Intergenic
1149427336 17:56568053-56568075 GAGTGGCCACAAAAGCACTGTGG + Intergenic
1150928902 17:69563433-69563455 GAGAGGCCTCACAATCATAGTGG - Intergenic
1151944289 17:77311118-77311140 GAGAGGCCACAGACACACCGGGG + Intronic
1152670270 17:81599977-81599999 GAAGGGACACACATGCACAGAGG + Intronic
1152784219 17:82239661-82239683 CAGAGGCCACCCTGGCACAGCGG - Exonic
1153487340 18:5613125-5613147 GAGAGGACACACTTGCAGAGAGG + Intronic
1154390518 18:13932610-13932632 GAGTGGCCACGCATGCAAAGGGG - Intergenic
1159359745 18:67384321-67384343 GAGAGGCCTCACAATCACAGTGG - Intergenic
1159579377 18:70218192-70218214 GGGAGGCCTCACAATCACAGTGG + Intergenic
1159705308 18:71678925-71678947 GCAAGGCCTCACACTCACAGTGG - Intergenic
1160632111 18:80254039-80254061 GACAGGCCACACCCACAGAGAGG - Intergenic
1161029921 19:2052870-2052892 AAGAGGAGACACACACACAGAGG - Intergenic
1163787021 19:19279972-19279994 GAGAGGCCACTCAGGTGCAGTGG + Intronic
1166305255 19:41933965-41933987 GAGAGGCCAGAGAGGCAGAGTGG + Intergenic
1166329021 19:42068258-42068280 GAGAGGCCAGACCCACACAGAGG + Intronic
1166732898 19:45068583-45068605 GAGAGGCCACGCAGGCACGGAGG + Intronic
1166765554 19:45250847-45250869 GAGAGACCCCACACACACACAGG - Intronic
925916525 2:8610905-8610927 GGGAGGCCTCACAATCACAGCGG + Intergenic
927519224 2:23689161-23689183 GAAAGGCCGCAGAGGCACAGGGG - Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
928413517 2:31072227-31072249 GAGAGGAGACATACACACAGTGG - Intronic
929020920 2:37552308-37552330 GAGAGGCCACACAACCTCAGAGG - Intergenic
930772381 2:55141192-55141214 GAGAGGACACACAGACCCAGAGG - Intergenic
931066786 2:58596703-58596725 GAGAGGCCACAGATACAAAGGGG - Intergenic
932193892 2:69766080-69766102 CAGAGGACAGACACACACAGAGG + Intronic
932311766 2:70748408-70748430 GAGAGGCCACACAAGACCAGAGG - Intronic
932312017 2:70750511-70750533 GAGAAGACACACACACACAGAGG + Intronic
933328172 2:80864360-80864382 GAGAGGCAACACAGACACTGAGG - Intergenic
933792618 2:85895145-85895167 GGGAGGCCTCACAATCACAGTGG - Intergenic
933823188 2:86133773-86133795 GTGAGGCAACACTGGCACAGAGG - Intronic
934069569 2:88371572-88371594 GAGCCACCACACACGGACAGAGG + Intergenic
934930413 2:98417793-98417815 GGGAGGCCTCACAATCACAGTGG + Intergenic
935426987 2:102929919-102929941 GAGGAGGCACACACACACAGTGG - Intergenic
935464881 2:103384532-103384554 GAGAAGACACAGACGCATAGAGG - Intergenic
936729404 2:115361777-115361799 GAGAGGCAACACAAACACTGAGG - Intronic
937031666 2:118745873-118745895 GGGAGGCCTCACAGTCACAGCGG + Intergenic
937744808 2:125399269-125399291 GAGAGTCTATCCACGCACAGAGG - Intergenic
938270673 2:129967652-129967674 GAGTGGTCACACAGGCACAGAGG - Intergenic
938577500 2:132618641-132618663 GGGAGGCCACACATGCACCAGGG + Intronic
939145144 2:138404612-138404634 AGGAGGCCACACAAGTACAGGGG + Intergenic
939600814 2:144187921-144187943 AAAAGGACACACACACACAGAGG + Intronic
939959323 2:148552319-148552341 GAGAGGCCACACACATGCACAGG + Intergenic
941303024 2:163827919-163827941 GAGAGGCCTCACAAGCACAGTGG + Intergenic
941862815 2:170301848-170301870 GAGCGGCCACATAGGCAAAGTGG + Intronic
942489761 2:176477424-176477446 CAGAGGCCAGGCAGGCACAGTGG - Intergenic
942773257 2:179548624-179548646 GAGAGGCCTCACAACCATAGTGG + Intronic
943576822 2:189639847-189639869 GGGAGGCCTCACAATCACAGTGG + Intergenic
944019982 2:195090701-195090723 GGGAGGCCTCACAATCACAGTGG + Intergenic
945043666 2:205763599-205763621 GAGAGGCCACAGCAGCACACTGG + Intronic
947978227 2:234386036-234386058 GAGAGGCCTCACAATCACGGTGG + Intergenic
949044931 2:241868051-241868073 AGGGGCCCACACACGCACAGTGG + Intergenic
1169089088 20:2846981-2847003 GAGAGGCCACACACTTAGTGAGG - Intronic
1173455137 20:43195767-43195789 GAGAGGTCACCCAAGCACACTGG + Intergenic
1173538732 20:43835554-43835576 AACAGGCCAGCCACGCACAGTGG + Intergenic
1173607008 20:44338586-44338608 CAGGTGCCACACACGCACAACGG - Intronic
1174046699 20:47738957-47738979 GAGAAGACGCACAGGCACAGAGG + Intronic
1174138029 20:48393875-48393897 GAGATGACACAGACGCACAGAGG + Intergenic
1175170040 20:57073975-57073997 GAAAGGACACAGACACACAGAGG - Intergenic
1175385393 20:58591707-58591729 GAGATGCCAGACAGGCCCAGAGG + Intergenic
1175916884 20:62430209-62430231 GGGAGGCCACACACACACTTGGG - Intergenic
1176023696 20:62975276-62975298 GAGAGGCCAGACATGCACCTAGG + Intergenic
1176375494 21:6085179-6085201 GAGAGGCCAGACAGGCACCCAGG - Intergenic
1177285293 21:19041300-19041322 GGGAGGCCTCACAATCACAGTGG + Intergenic
1178904762 21:36627291-36627313 GAAAGGCCACAGAGACACAGAGG - Intergenic
1179512139 21:41879813-41879835 GAGAGGCCACACAGGCCCCCGGG - Intergenic
1179747980 21:43453065-43453087 GAGAGGCCAGACAGGCACCCAGG + Intergenic
1180814049 22:18778688-18778710 GGCAGGCCCCACACCCACAGTGG + Intergenic
1181701505 22:24623936-24623958 GGCAGGCCCCACACCCACAGTGG - Intronic
1182115901 22:27756235-27756257 GAGATGCCACCCACCCATAGAGG + Intronic
1182713729 22:32338871-32338893 GAAAGGCCACAAACTCACAAAGG + Intergenic
1183535090 22:38396878-38396900 CAGAGGCCTGACACACACAGTGG + Intronic
1183638384 22:39078483-39078505 GAGGGGCCAGACGCGCAGAGAGG - Intronic
1183975226 22:41508097-41508119 GAGAGGCCTCACCCTCACACTGG + Intronic
1184236026 22:43183488-43183510 GAGAGGCCCCAAAGGCAGAGAGG + Intronic
1184385107 22:44169661-44169683 GTGAGGACACAGACACACAGAGG - Intronic
1184992996 22:48183177-48183199 GTGAGGCCACCCAGGCGCAGTGG - Intergenic
1203226603 22_KI270731v1_random:81901-81923 GGCAGGCCCCACACCCACAGTGG - Intergenic
953998289 3:47537001-47537023 GAGAGGCCGCACTGGAACAGGGG - Intergenic
954138554 3:48593602-48593624 GGGGGGCAACACTCGCACAGGGG - Exonic
957105500 3:75882714-75882736 GAGAGGCCTCACAATCATAGCGG + Intergenic
957684500 3:83483474-83483496 GGGAGGCCTCACAATCACAGTGG - Intergenic
963345621 3:144093564-144093586 GGGAGGCCTCACAATCACAGTGG - Intergenic
965549949 3:169954225-169954247 TAAAAGCCACACACACACAGAGG - Intergenic
966298280 3:178449561-178449583 GAGAGGCCTCACAAGCACGTTGG + Intronic
966865906 3:184259198-184259220 CAGCGGCCACACACACACAGAGG + Exonic
968566371 4:1315753-1315775 GAGGGGGGACACACGCACACGGG - Intronic
969472350 4:7396455-7396477 GCGAGGCCACTGACTCACAGGGG - Intronic
969503540 4:7569870-7569892 GAGAGGCCACATCCACCCAGTGG - Intronic
971330298 4:25676297-25676319 GAGAGGCCAAACACCGTCAGCGG - Exonic
972523220 4:39882024-39882046 GGGAGGCCTCACAATCACAGTGG - Intronic
973918480 4:55660958-55660980 GAGAGGCCTCACAATCATAGTGG + Intergenic
975834512 4:78408056-78408078 GAGAGGCCTCACAATCACAGTGG + Intronic
976731355 4:88265493-88265515 GAGAGGCCACACAATCATGGTGG - Intronic
977977886 4:103287722-103287744 GGGAGGCCTCACAGTCACAGTGG - Intergenic
979125885 4:116970935-116970957 GAGAGGCCACACAATCACGGTGG + Intergenic
979231253 4:118351919-118351941 GAGCGCACACACACACACAGTGG + Intronic
979337712 4:119482604-119482626 CAGAGGTCACACACACACACGGG + Intergenic
979923125 4:126525706-126525728 GAGAGGCCTCAGAATCACAGTGG + Intergenic
981549124 4:145925013-145925035 GGGAGGCCTCACAATCACAGTGG + Intronic
983727022 4:170941067-170941089 GAGAGGTCACTCAAGCACACTGG - Intergenic
985304062 4:188520141-188520163 GGGAGGCCTCACAATCACAGTGG - Intergenic
986327183 5:6685040-6685062 GAGGGGCAGCACAGGCACAGGGG - Intergenic
986758186 5:10856976-10856998 GAGATGAAACACAGGCACAGCGG - Intergenic
987927847 5:24364981-24365003 TAGAGGCCACCAACTCACAGAGG + Intergenic
988964781 5:36404944-36404966 GAGAGGTCAGACTCACACAGAGG - Intergenic
989323535 5:40164843-40164865 GAGAGGTGACACAGGCACTGGGG + Intergenic
989380287 5:40803755-40803777 GGGAGGCCACCCAGGCACAGTGG + Intergenic
990320005 5:54620598-54620620 GAGAGGTGACACAAGAACAGAGG + Intergenic
991006906 5:61836879-61836901 GGGAGGCCTCACAATCACAGTGG - Intergenic
994511546 5:100709725-100709747 GAGAGGCAACACAGACACTGAGG - Intergenic
994715697 5:103318954-103318976 GGGAGGCCTCACAATCACAGTGG - Intergenic
996313906 5:122139910-122139932 GAGAGGACTTACAAGCACAGTGG + Intronic
997022584 5:130018934-130018956 AAGCGGGCACACATGCACAGAGG - Intronic
997626149 5:135331900-135331922 TAGAGGACACACACATACAGTGG + Intronic
998497641 5:142604633-142604655 AAAAGGCCACAAAAGCACAGAGG - Intronic
1001674483 5:173500644-173500666 GAGAGGACACACAGCCACACAGG + Intergenic
1001709437 5:173766421-173766443 GTCATGCCACACACCCACAGAGG - Intergenic
1002373481 5:178772644-178772666 GAGAGGGCACACATTCACACAGG + Intergenic
1002765183 6:233170-233192 GAGAGGACACAGACCCACAGAGG + Intergenic
1003051289 6:2783143-2783165 GAGTGCACGCACACGCACAGAGG - Intronic
1004258264 6:14084878-14084900 GGGTGGCCAAACACGCACACTGG + Intergenic
1006028490 6:31162370-31162392 GTGAGGCCACAGAGGCACAGTGG - Intronic
1006288330 6:33115241-33115263 GAGAGGATACACACTCAGAGTGG + Intergenic
1006920349 6:37623885-37623907 GAAAGGCCACAGAAGAACAGAGG - Intergenic
1008070381 6:47093414-47093436 AAGAGGCCAAACAGCCACAGTGG + Intergenic
1009498905 6:64386340-64386362 GTGAGGCCTCACAATCACAGTGG + Intronic
1009534139 6:64859688-64859710 GGGAGGCCTCACAATCACAGGGG - Intronic
1009769264 6:68123118-68123140 GAGAGGCCTCACAATCACGGTGG + Intergenic
1011240436 6:85266496-85266518 GAGAGGCCTCACAATCACAGTGG + Intergenic
1011424643 6:87213384-87213406 GTGAGACCACACCCGGACAGGGG + Intronic
1011705077 6:89993014-89993036 CACTGTCCACACACGCACAGAGG + Intronic
1012670731 6:102043951-102043973 GGGAGGCCTCACAATCACAGAGG - Intronic
1016078083 6:139821229-139821251 AAGAGGTCACACACACAGAGTGG + Intergenic
1017771719 6:157649602-157649624 GAGGGGCAACTCAAGCACAGGGG - Intronic
1017964944 6:159256060-159256082 GAGAGACCCCACACGCCCAGGGG - Intronic
1018716035 6:166533391-166533413 GAGAGGCCGCACTGGCAGAGAGG + Intronic
1019226302 6:170512772-170512794 GAGGGTACACACACACACAGGGG + Intergenic
1020097301 7:5376307-5376329 GAGGGGCCACACCCACACAGTGG + Intronic
1021598727 7:22343107-22343129 GAGAGGCCTCACAATCACGGAGG + Intronic
1021841199 7:24723180-24723202 GAGAGGCCCCACAGGGACAGCGG + Intronic
1022609727 7:31857630-31857652 GACAGACCACACAAACACAGAGG + Intronic
1022702462 7:32774741-32774763 GAGGGGCCAAACACACACATGGG - Intergenic
1024271066 7:47641845-47641867 GAGAGGCCAGACCCTCACAGTGG + Intergenic
1024614218 7:51095139-51095161 GGGAGGCCTCACAATCACAGTGG + Intronic
1026262550 7:68767856-68767878 GAGAGCACACACACACACACAGG + Intergenic
1026566438 7:71493478-71493500 GAGAGGCCTCACAATCACGGTGG + Intronic
1026889891 7:73975520-73975542 GGGAGACCAGACACCCACAGAGG + Intergenic
1029851585 7:103466825-103466847 GGGAGGCCTCACAATCACAGTGG + Intergenic
1030826696 7:114168032-114168054 GGGAGGCCTCACAATCACAGTGG - Intronic
1031184326 7:118456801-118456823 GGGAGGCCTCACAATCACAGTGG - Intergenic
1032161645 7:129515485-129515507 GGGAGGCCTCACAATCACAGTGG - Intergenic
1032328186 7:130951625-130951647 TAGATGCCACACATGCATAGAGG - Intergenic
1032963381 7:137066743-137066765 GAGAGGCCTCACAATCACGGTGG - Intergenic
1034960454 7:155361371-155361393 GGGAGGCCCCACAGGCACCGAGG + Intronic
1035140899 7:156759794-156759816 GAGAGAGCACACCTGCACAGGGG + Intronic
1036183753 8:6606914-6606936 GGGAGGCCTCACACTCATAGTGG - Intronic
1037833981 8:22205485-22205507 AAGAGGCCAGCCAGGCACAGTGG + Intronic
1040482650 8:47840987-47841009 GAGAGGCAACACAGACACTGAGG + Intronic
1040994989 8:53392212-53392234 TAGAGACCACACACACACAGGGG + Intergenic
1042298045 8:67243336-67243358 GAGAGGCCTCACAATCATAGTGG + Intronic
1043186513 8:77158468-77158490 GAGAAGACACACACACACAGAGG + Intergenic
1046779648 8:118201425-118201447 GAGATGCCACACTCGCACACAGG - Intronic
1048551945 8:135441677-135441699 GGGAGGCCTCACAATCACAGTGG + Intergenic
1053574655 9:39346090-39346112 GGGAGGCCTCACAATCACAGTGG - Intergenic
1053594632 9:39547042-39547064 GCGAGGCCTCACAATCACAGTGG - Intergenic
1053852408 9:42302075-42302097 GCGAGGCCTCACAATCACAGTGG - Intergenic
1054096219 9:60904780-60904802 GGGAGGCCTCACAATCACAGTGG - Intergenic
1054117678 9:61180719-61180741 GGGAGGCCTCACAATCACAGTGG - Intergenic
1054191905 9:61990687-61990709 GAGGGGCCACACAGGCACTCTGG + Intergenic
1054448793 9:65391259-65391281 CCAAGGACACACACGCACAGGGG + Intergenic
1054571630 9:66817930-66817952 GCGAGGCCTCACAATCACAGTGG + Intergenic
1054646475 9:67597103-67597125 GAGGGGCCACACAGGCACTCTGG - Intergenic
1054707083 9:68473668-68473690 GAGAGGCCACTCACTCAAAGAGG - Intronic
1056432068 9:86537655-86537677 GGGAGGCCTCACAAGCATAGCGG + Intergenic
1057229114 9:93308277-93308299 GTGACGCCACACACGCACCCAGG - Intronic
1058748492 9:108015781-108015803 GAGAGGCCACACAGGCCTGGGGG - Intergenic
1059711166 9:116868863-116868885 GAGAGGACACACAGACACACAGG - Intronic
1060210865 9:121709379-121709401 GAGTGGCCACTCACGGGCAGTGG - Intronic
1062158318 9:135066397-135066419 GGGAGGAGACACATGCACAGGGG + Intergenic
1062158341 9:135066503-135066525 GAGAGGAGGCACACGCACGGGGG + Intergenic
1062166811 9:135112054-135112076 GAAAGGGCACACCTGCACAGGGG + Intronic
1185485052 X:475731-475753 AAGAGGACACACAGACACAGAGG - Intergenic
1185629040 X:1502772-1502794 GAGAGGAGACACAGACACAGAGG + Intronic
1185699150 X:2217302-2217324 AAGAAGACACACACACACAGAGG + Intergenic
1185722913 X:2396142-2396164 GAGAGGAGACACAGACACAGAGG - Intronic
1185914708 X:4023169-4023191 GACTGGCCACACCGGCACAGGGG - Intergenic
1186019590 X:5239376-5239398 GGGAGGCCTCACAATCACAGTGG + Intergenic
1188052818 X:25508514-25508536 GGGAGGCCTCACAATCACAGTGG + Intergenic
1188124368 X:26350367-26350389 GAGAGGCCTCACAATCACGGTGG + Intergenic
1189217389 X:39337807-39337829 CAGAGGACACACACACACACCGG + Intergenic
1189236491 X:39490965-39490987 GAGAGGCCAGACACAGACTGTGG - Intergenic
1189679213 X:43497564-43497586 GAGAGGCCTCACAATCACGGTGG - Intergenic
1189923529 X:45929186-45929208 GAAATTACACACACGCACAGAGG - Intergenic
1190732240 X:53233863-53233885 GAGAGCTCACACAGGCCCAGAGG + Exonic
1191221504 X:57992464-57992486 AAGAGGCCAGAAACACACAGTGG - Intergenic
1192124327 X:68487788-68487810 GAGAATCCACACATGGACAGAGG + Intergenic
1192298864 X:69879783-69879805 TGGAGGCTACACAGGCACAGAGG - Intronic
1193881332 X:86925126-86925148 GAGAGAACACACACACACTGTGG - Intergenic
1195239857 X:102940247-102940269 CAGAGGCCACACACACACCCTGG - Intergenic
1195939413 X:110155596-110155618 GAGAGCCCACAGTCGGACAGGGG - Intronic
1196565093 X:117195906-117195928 GAGAGGCCTCACAATCATAGTGG - Intergenic
1197204833 X:123780914-123780936 GAGAGGCCAGAAACCCAGAGAGG + Intergenic
1197507622 X:127327425-127327447 GAGAGGCCCCACAATCACGGTGG + Intergenic
1202074249 Y:21022493-21022515 GCGAGACCACAAACCCACAGAGG - Intergenic