ID: 1137753755

View in Genome Browser
Species Human (GRCh38)
Location 16:50885651-50885673
Sequence CAGTAGGGCTGGAATGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137753755_1137753765 20 Left 1137753755 16:50885651-50885673 CCTACTGCATTCCAGCCCTACTG No data
Right 1137753765 16:50885694-50885716 ATCTGGGAGAAGAATGTTCTAGG No data
1137753755_1137753767 27 Left 1137753755 16:50885651-50885673 CCTACTGCATTCCAGCCCTACTG No data
Right 1137753767 16:50885701-50885723 AGAAGAATGTTCTAGGCAGAGGG No data
1137753755_1137753763 4 Left 1137753755 16:50885651-50885673 CCTACTGCATTCCAGCCCTACTG No data
Right 1137753763 16:50885678-50885700 CCTGACCTATGAGTTTATCTGGG No data
1137753755_1137753761 3 Left 1137753755 16:50885651-50885673 CCTACTGCATTCCAGCCCTACTG No data
Right 1137753761 16:50885677-50885699 TCCTGACCTATGAGTTTATCTGG No data
1137753755_1137753766 26 Left 1137753755 16:50885651-50885673 CCTACTGCATTCCAGCCCTACTG No data
Right 1137753766 16:50885700-50885722 GAGAAGAATGTTCTAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137753755 Original CRISPR CAGTAGGGCTGGAATGCAGT AGG (reversed) Intergenic
No off target data available for this crispr