ID: 1137754352 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:50889601-50889623 |
| Sequence | CAGTCTGAGCAGGGTGATGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1137754352_1137754359 | 9 | Left | 1137754352 | 16:50889601-50889623 | CCTTCATCACCCTGCTCAGACTG | No data | ||
| Right | 1137754359 | 16:50889633-50889655 | CTTGGCATTCCACACTCCCTTGG | No data | ||||
| 1137754352_1137754361 | 24 | Left | 1137754352 | 16:50889601-50889623 | CCTTCATCACCCTGCTCAGACTG | No data | ||
| Right | 1137754361 | 16:50889648-50889670 | TCCCTTGGTACTGCAAGACAAGG | No data | ||||
| 1137754352_1137754355 | -9 | Left | 1137754352 | 16:50889601-50889623 | CCTTCATCACCCTGCTCAGACTG | No data | ||
| Right | 1137754355 | 16:50889615-50889637 | CTCAGACTGCACTCCACCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1137754352 | Original CRISPR | CAGTCTGAGCAGGGTGATGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||