ID: 1137754352

View in Genome Browser
Species Human (GRCh38)
Location 16:50889601-50889623
Sequence CAGTCTGAGCAGGGTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137754352_1137754359 9 Left 1137754352 16:50889601-50889623 CCTTCATCACCCTGCTCAGACTG No data
Right 1137754359 16:50889633-50889655 CTTGGCATTCCACACTCCCTTGG No data
1137754352_1137754361 24 Left 1137754352 16:50889601-50889623 CCTTCATCACCCTGCTCAGACTG No data
Right 1137754361 16:50889648-50889670 TCCCTTGGTACTGCAAGACAAGG No data
1137754352_1137754355 -9 Left 1137754352 16:50889601-50889623 CCTTCATCACCCTGCTCAGACTG No data
Right 1137754355 16:50889615-50889637 CTCAGACTGCACTCCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137754352 Original CRISPR CAGTCTGAGCAGGGTGATGA AGG (reversed) Intergenic
No off target data available for this crispr