ID: 1137757395

View in Genome Browser
Species Human (GRCh38)
Location 16:50913519-50913541
Sequence CTTAGCATGTAGACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137757389_1137757395 24 Left 1137757389 16:50913472-50913494 CCTCTGCAAACATGCAGGTCTAT No data
Right 1137757395 16:50913519-50913541 CTTAGCATGTAGACTGTGGAAGG No data
1137757391_1137757395 -1 Left 1137757391 16:50913497-50913519 CCTTAGATTTGAAGGTGTCCCTC No data
Right 1137757395 16:50913519-50913541 CTTAGCATGTAGACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137757395 Original CRISPR CTTAGCATGTAGACTGTGGA AGG Intergenic
No off target data available for this crispr