ID: 1137757433

View in Genome Browser
Species Human (GRCh38)
Location 16:50913844-50913866
Sequence AAGAAAACAAAAATGATGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137757433_1137757434 -10 Left 1137757433 16:50913844-50913866 CCTCGCATCATTTTTGTTTTCTT No data
Right 1137757434 16:50913857-50913879 TTGTTTTCTTTAAAATGAGAAGG No data
1137757433_1137757436 -4 Left 1137757433 16:50913844-50913866 CCTCGCATCATTTTTGTTTTCTT No data
Right 1137757436 16:50913863-50913885 TCTTTAAAATGAGAAGGTGGAGG No data
1137757433_1137757438 6 Left 1137757433 16:50913844-50913866 CCTCGCATCATTTTTGTTTTCTT No data
Right 1137757438 16:50913873-50913895 GAGAAGGTGGAGGGTGAACCTGG No data
1137757433_1137757435 -7 Left 1137757433 16:50913844-50913866 CCTCGCATCATTTTTGTTTTCTT No data
Right 1137757435 16:50913860-50913882 TTTTCTTTAAAATGAGAAGGTGG No data
1137757433_1137757437 -3 Left 1137757433 16:50913844-50913866 CCTCGCATCATTTTTGTTTTCTT No data
Right 1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137757433 Original CRISPR AAGAAAACAAAAATGATGCG AGG (reversed) Intergenic
No off target data available for this crispr