ID: 1137757437

View in Genome Browser
Species Human (GRCh38)
Location 16:50913864-50913886
Sequence CTTTAAAATGAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137757433_1137757437 -3 Left 1137757433 16:50913844-50913866 CCTCGCATCATTTTTGTTTTCTT No data
Right 1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137757437 Original CRISPR CTTTAAAATGAGAAGGTGGA GGG Intergenic
No off target data available for this crispr