ID: 1137758873

View in Genome Browser
Species Human (GRCh38)
Location 16:50924655-50924677
Sequence TTAAGGATTTTGTAGTGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137758873_1137758880 7 Left 1137758873 16:50924655-50924677 CCGGCCCACTACAAAATCCTTAA No data
Right 1137758880 16:50924685-50924707 ACTCCAAACTCCTCCAGAGATGG No data
1137758873_1137758882 15 Left 1137758873 16:50924655-50924677 CCGGCCCACTACAAAATCCTTAA No data
Right 1137758882 16:50924693-50924715 CTCCTCCAGAGATGGATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137758873 Original CRISPR TTAAGGATTTTGTAGTGGGC CGG (reversed) Intergenic
No off target data available for this crispr