ID: 1137759112

View in Genome Browser
Species Human (GRCh38)
Location 16:50926376-50926398
Sequence TCCAATAAGTTCATGGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137759112_1137759115 -5 Left 1137759112 16:50926376-50926398 CCCAAAGCCATGAACTTATTGGA No data
Right 1137759115 16:50926394-50926416 TTGGATGTGTATCATATGCCAGG No data
1137759112_1137759117 18 Left 1137759112 16:50926376-50926398 CCCAAAGCCATGAACTTATTGGA No data
Right 1137759117 16:50926417-50926439 TACTGTTCTGTCCTCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137759112 Original CRISPR TCCAATAAGTTCATGGCTTT GGG (reversed) Intergenic
No off target data available for this crispr