ID: 1137760309

View in Genome Browser
Species Human (GRCh38)
Location 16:50935064-50935086
Sequence CTTCTTTTCTTGGGCACCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137760301_1137760309 26 Left 1137760301 16:50935015-50935037 CCTGGTAGGCAGACAGCATCCAC No data
Right 1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG No data
1137760302_1137760309 7 Left 1137760302 16:50935034-50935056 CCACCCAACACTGTCTTCCTCTT No data
Right 1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG No data
1137760303_1137760309 4 Left 1137760303 16:50935037-50935059 CCCAACACTGTCTTCCTCTTTGT No data
Right 1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG No data
1137760304_1137760309 3 Left 1137760304 16:50935038-50935060 CCAACACTGTCTTCCTCTTTGTC No data
Right 1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG No data
1137760305_1137760309 -10 Left 1137760305 16:50935051-50935073 CCTCTTTGTCTTTCTTCTTTTCT No data
Right 1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137760309 Original CRISPR CTTCTTTTCTTGGGCACCAA GGG Intergenic
No off target data available for this crispr