ID: 1137762592

View in Genome Browser
Species Human (GRCh38)
Location 16:50952631-50952653
Sequence GTGGACAAAACGAAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137762588_1137762592 9 Left 1137762588 16:50952599-50952621 CCACTATAATCAGGTGGACACAA No data
Right 1137762592 16:50952631-50952653 GTGGACAAAACGAAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137762592 Original CRISPR GTGGACAAAACGAAGGCTGC TGG Intergenic
No off target data available for this crispr