ID: 1137768011

View in Genome Browser
Species Human (GRCh38)
Location 16:50992690-50992712
Sequence CCTGTTCCACACTCAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137768011_1137768013 6 Left 1137768011 16:50992690-50992712 CCTGGCTCTGAGTGTGGAACAGG No data
Right 1137768013 16:50992719-50992741 ACCTTAAAGATACCCCAGTTTGG No data
1137768011_1137768015 7 Left 1137768011 16:50992690-50992712 CCTGGCTCTGAGTGTGGAACAGG No data
Right 1137768015 16:50992720-50992742 CCTTAAAGATACCCCAGTTTGGG No data
1137768011_1137768019 26 Left 1137768011 16:50992690-50992712 CCTGGCTCTGAGTGTGGAACAGG No data
Right 1137768019 16:50992739-50992761 TGGGCCCGATAGAGATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137768011 Original CRISPR CCTGTTCCACACTCAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr