ID: 1137768355

View in Genome Browser
Species Human (GRCh38)
Location 16:50995147-50995169
Sequence CAGACATCACTAATGGATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137768349_1137768355 2 Left 1137768349 16:50995122-50995144 CCACCCTCTCTTCCTATGTCCAT No data
Right 1137768355 16:50995147-50995169 CAGACATCACTAATGGATCACGG No data
1137768352_1137768355 -10 Left 1137768352 16:50995134-50995156 CCTATGTCCATGACAGACATCAC No data
Right 1137768355 16:50995147-50995169 CAGACATCACTAATGGATCACGG No data
1137768350_1137768355 -1 Left 1137768350 16:50995125-50995147 CCCTCTCTTCCTATGTCCATGAC No data
Right 1137768355 16:50995147-50995169 CAGACATCACTAATGGATCACGG No data
1137768351_1137768355 -2 Left 1137768351 16:50995126-50995148 CCTCTCTTCCTATGTCCATGACA No data
Right 1137768355 16:50995147-50995169 CAGACATCACTAATGGATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137768355 Original CRISPR CAGACATCACTAATGGATCA CGG Intergenic
No off target data available for this crispr