ID: 1137768548

View in Genome Browser
Species Human (GRCh38)
Location 16:50996437-50996459
Sequence CCCAGGAGCTGGGTTTTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137768548_1137768564 24 Left 1137768548 16:50996437-50996459 CCTGCGAAAACCCAGCTCCTGGG No data
Right 1137768564 16:50996484-50996506 CTTGGCTCCCCTGTCCTTGTGGG No data
1137768548_1137768563 23 Left 1137768548 16:50996437-50996459 CCTGCGAAAACCCAGCTCCTGGG No data
Right 1137768563 16:50996483-50996505 CCTTGGCTCCCCTGTCCTTGTGG No data
1137768548_1137768560 6 Left 1137768548 16:50996437-50996459 CCTGCGAAAACCCAGCTCCTGGG No data
Right 1137768560 16:50996466-50996488 GGGTTCCTGCTCAGGATCCTTGG No data
1137768548_1137768556 -2 Left 1137768548 16:50996437-50996459 CCTGCGAAAACCCAGCTCCTGGG No data
Right 1137768556 16:50996458-50996480 GGGACCCCGGGTTCCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137768548 Original CRISPR CCCAGGAGCTGGGTTTTCGC AGG (reversed) Intergenic
No off target data available for this crispr