ID: 1137771387

View in Genome Browser
Species Human (GRCh38)
Location 16:51018319-51018341
Sequence GAGGGTAAAATGAAGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137771383_1137771387 3 Left 1137771383 16:51018293-51018315 CCTGTAAGTTAGGAAATTGGTAA No data
Right 1137771387 16:51018319-51018341 GAGGGTAAAATGAAGGAGCTTGG No data
1137771380_1137771387 16 Left 1137771380 16:51018280-51018302 CCTGGGAAAAGATCCTGTAAGTT No data
Right 1137771387 16:51018319-51018341 GAGGGTAAAATGAAGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137771387 Original CRISPR GAGGGTAAAATGAAGGAGCT TGG Intergenic
No off target data available for this crispr