ID: 1137771454

View in Genome Browser
Species Human (GRCh38)
Location 16:51019124-51019146
Sequence GTGTTAAAACAGGAGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137771448_1137771454 -7 Left 1137771448 16:51019108-51019130 CCCCTGAGCATGGCCTGTGTTAA No data
Right 1137771454 16:51019124-51019146 GTGTTAAAACAGGAGGTGCATGG No data
1137771447_1137771454 -6 Left 1137771447 16:51019107-51019129 CCCCCTGAGCATGGCCTGTGTTA No data
Right 1137771454 16:51019124-51019146 GTGTTAAAACAGGAGGTGCATGG No data
1137771449_1137771454 -8 Left 1137771449 16:51019109-51019131 CCCTGAGCATGGCCTGTGTTAAA No data
Right 1137771454 16:51019124-51019146 GTGTTAAAACAGGAGGTGCATGG No data
1137771450_1137771454 -9 Left 1137771450 16:51019110-51019132 CCTGAGCATGGCCTGTGTTAAAA No data
Right 1137771454 16:51019124-51019146 GTGTTAAAACAGGAGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137771454 Original CRISPR GTGTTAAAACAGGAGGTGCA TGG Intergenic
No off target data available for this crispr