ID: 1137774383

View in Genome Browser
Species Human (GRCh38)
Location 16:51043235-51043257
Sequence TTGAGACAGGGGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137774383_1137774391 6 Left 1137774383 16:51043235-51043257 CCACCCACCTTCCCCTGTCTCAA No data
Right 1137774391 16:51043264-51043286 CAGCTCCTCCAAACCCCCTCTGG No data
1137774383_1137774393 11 Left 1137774383 16:51043235-51043257 CCACCCACCTTCCCCTGTCTCAA No data
Right 1137774393 16:51043269-51043291 CCTCCAAACCCCCTCTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137774383 Original CRISPR TTGAGACAGGGGAAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr