ID: 1137774519

View in Genome Browser
Species Human (GRCh38)
Location 16:51044149-51044171
Sequence GCTGCCTGAACCCCAGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137774519_1137774526 26 Left 1137774519 16:51044149-51044171 CCACCCGCTGGGGTTCAGGCAGC No data
Right 1137774526 16:51044198-51044220 TCTTCCCTTTGCCCATTCCTTGG No data
1137774519_1137774522 -2 Left 1137774519 16:51044149-51044171 CCACCCGCTGGGGTTCAGGCAGC No data
Right 1137774522 16:51044170-51044192 GCCAGCAGCTGCCTGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137774519 Original CRISPR GCTGCCTGAACCCCAGCGGG TGG (reversed) Intergenic
No off target data available for this crispr