ID: 1137775236

View in Genome Browser
Species Human (GRCh38)
Location 16:51048669-51048691
Sequence GCATCTTGTGGGAGACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137775222_1137775236 26 Left 1137775222 16:51048620-51048642 CCACAATGCCCTTCCCTGTAGAT No data
Right 1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG No data
1137775228_1137775236 13 Left 1137775228 16:51048633-51048655 CCCTGTAGATTTCAGGTGAGGGT No data
Right 1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG No data
1137775221_1137775236 27 Left 1137775221 16:51048619-51048641 CCCACAATGCCCTTCCCTGTAGA No data
Right 1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG No data
1137775229_1137775236 12 Left 1137775229 16:51048634-51048656 CCTGTAGATTTCAGGTGAGGGTA No data
Right 1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG No data
1137775225_1137775236 17 Left 1137775225 16:51048629-51048651 CCTTCCCTGTAGATTTCAGGTGA No data
Right 1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG No data
1137775224_1137775236 18 Left 1137775224 16:51048628-51048650 CCCTTCCCTGTAGATTTCAGGTG No data
Right 1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137775236 Original CRISPR GCATCTTGTGGGAGACATGG AGG Intergenic
No off target data available for this crispr