ID: 1137776803

View in Genome Browser
Species Human (GRCh38)
Location 16:51062062-51062084
Sequence ATATTAACCTTTGAGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137776803_1137776808 15 Left 1137776803 16:51062062-51062084 CCCTAGATCTCAAAGGTTAATAT No data
Right 1137776808 16:51062100-51062122 AAACATGAGTGCTGTCAGAGAGG No data
1137776803_1137776807 -8 Left 1137776803 16:51062062-51062084 CCCTAGATCTCAAAGGTTAATAT No data
Right 1137776807 16:51062077-51062099 GTTAATATCTGTTGGGCATTTGG No data
1137776803_1137776809 22 Left 1137776803 16:51062062-51062084 CCCTAGATCTCAAAGGTTAATAT No data
Right 1137776809 16:51062107-51062129 AGTGCTGTCAGAGAGGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137776803 Original CRISPR ATATTAACCTTTGAGATCTA GGG (reversed) Intergenic
No off target data available for this crispr