ID: 1137778212

View in Genome Browser
Species Human (GRCh38)
Location 16:51074160-51074182
Sequence GGCCAGATTCAGAACCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137778212_1137778221 27 Left 1137778212 16:51074160-51074182 CCTCCAAGGTTCTGAATCTGGCC No data
Right 1137778221 16:51074210-51074232 TTCACATTCATCTCCCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137778212 Original CRISPR GGCCAGATTCAGAACCTTGG AGG (reversed) Intergenic
No off target data available for this crispr