ID: 1137778301

View in Genome Browser
Species Human (GRCh38)
Location 16:51075012-51075034
Sequence CCTGCAGATGGGGATGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137778301_1137778309 20 Left 1137778301 16:51075012-51075034 CCTCAAGCATCCCCATCTGCAGG No data
Right 1137778309 16:51075055-51075077 AAAAATATATAAGTTAGGCCAGG No data
1137778301_1137778310 28 Left 1137778301 16:51075012-51075034 CCTCAAGCATCCCCATCTGCAGG No data
Right 1137778310 16:51075063-51075085 ATAAGTTAGGCCAGGTGCCGTGG No data
1137778301_1137778308 15 Left 1137778301 16:51075012-51075034 CCTCAAGCATCCCCATCTGCAGG No data
Right 1137778308 16:51075050-51075072 TTTTAAAAAATATATAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137778301 Original CRISPR CCTGCAGATGGGGATGCTTG AGG (reversed) Intergenic