ID: 1137779089

View in Genome Browser
Species Human (GRCh38)
Location 16:51081921-51081943
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137779089_1137779093 21 Left 1137779089 16:51081921-51081943 CCTGTATTTCAAAGCAAAACTTT No data
Right 1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG No data
1137779089_1137779090 -1 Left 1137779089 16:51081921-51081943 CCTGTATTTCAAAGCAAAACTTT No data
Right 1137779090 16:51081943-51081965 TACCAAGTATGAATGCAGACAGG No data
1137779089_1137779091 0 Left 1137779089 16:51081921-51081943 CCTGTATTTCAAAGCAAAACTTT No data
Right 1137779091 16:51081944-51081966 ACCAAGTATGAATGCAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137779089 Original CRISPR AAAGTTTTGCTTTGAAATAC AGG (reversed) Intergenic
No off target data available for this crispr