ID: 1137779092

View in Genome Browser
Species Human (GRCh38)
Location 16:51081945-51081967
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137779092_1137779093 -3 Left 1137779092 16:51081945-51081967 CCAAGTATGAATGCAGACAGGGA No data
Right 1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137779092 Original CRISPR TCCCTGTCTGCATTCATACT TGG (reversed) Intergenic
No off target data available for this crispr