ID: 1137779093

View in Genome Browser
Species Human (GRCh38)
Location 16:51081965-51081987
Sequence GGAGAAAATACTACCTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137779088_1137779093 27 Left 1137779088 16:51081915-51081937 CCTTTTCCTGTATTTCAAAGCAA No data
Right 1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG No data
1137779089_1137779093 21 Left 1137779089 16:51081921-51081943 CCTGTATTTCAAAGCAAAACTTT No data
Right 1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG No data
1137779092_1137779093 -3 Left 1137779092 16:51081945-51081967 CCAAGTATGAATGCAGACAGGGA No data
Right 1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG No data
1137779087_1137779093 28 Left 1137779087 16:51081914-51081936 CCCTTTTCCTGTATTTCAAAGCA No data
Right 1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137779093 Original CRISPR GGAGAAAATACTACCTGTGT AGG Intergenic
No off target data available for this crispr