ID: 1137783341

View in Genome Browser
Species Human (GRCh38)
Location 16:51115997-51116019
Sequence GCTGCTGCTGCTACAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137783338_1137783341 3 Left 1137783338 16:51115971-51115993 CCCAGTATGCTGCTGCTGCTCCT No data
Right 1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG No data
1137783335_1137783341 21 Left 1137783335 16:51115953-51115975 CCACCAACAGCTGTTGTCCCCAG No data
Right 1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG No data
1137783336_1137783341 18 Left 1137783336 16:51115956-51115978 CCAACAGCTGTTGTCCCCAGTAT No data
Right 1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG No data
1137783339_1137783341 2 Left 1137783339 16:51115972-51115994 CCAGTATGCTGCTGCTGCTCCTG No data
Right 1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG No data
1137783337_1137783341 4 Left 1137783337 16:51115970-51115992 CCCCAGTATGCTGCTGCTGCTCC No data
Right 1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG No data
1137783334_1137783341 29 Left 1137783334 16:51115945-51115967 CCTGTTTACCACCAACAGCTGTT No data
Right 1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137783341 Original CRISPR GCTGCTGCTGCTACAGCTCC AGG Intergenic
No off target data available for this crispr