ID: 1137785456

View in Genome Browser
Species Human (GRCh38)
Location 16:51134398-51134420
Sequence GCCCGGAGTGCGGGAGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137785446_1137785456 12 Left 1137785446 16:51134363-51134385 CCCAAGGTGGTGCAGGGCGGTGA No data
Right 1137785456 16:51134398-51134420 GCCCGGAGTGCGGGAGCCCCGGG No data
1137785447_1137785456 11 Left 1137785447 16:51134364-51134386 CCAAGGTGGTGCAGGGCGGTGAC No data
Right 1137785456 16:51134398-51134420 GCCCGGAGTGCGGGAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137785456 Original CRISPR GCCCGGAGTGCGGGAGCCCC GGG Intergenic
No off target data available for this crispr