ID: 1137786231

View in Genome Browser
Species Human (GRCh38)
Location 16:51140003-51140025
Sequence CCCTTTAAGTGTAAGATCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137786231_1137786237 15 Left 1137786231 16:51140003-51140025 CCACAGATCTTACACTTAAAGGG 0: 1
1: 1
2: 0
3: 17
4: 172
Right 1137786237 16:51140041-51140063 TGTCCTGTAGTGCATTTTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 169
1137786231_1137786239 23 Left 1137786231 16:51140003-51140025 CCACAGATCTTACACTTAAAGGG 0: 1
1: 1
2: 0
3: 17
4: 172
Right 1137786239 16:51140049-51140071 AGTGCATTTTCAAGGCGCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137786231 Original CRISPR CCCTTTAAGTGTAAGATCTG TGG (reversed) Exonic
902365934 1:15974472-15974494 CCATTTAAGAATCAGATCTGTGG - Intronic
902455452 1:16530683-16530705 CACTTTCAGGGTAACATCTGGGG + Intergenic
906065890 1:42979920-42979942 ACCTCTCAGTGTAAGAGCTGAGG + Intergenic
908450492 1:64250031-64250053 TCCTTTATGTGTAACATGTGGGG - Intronic
908905845 1:69007827-69007849 CTCTTTAAGAGTATGATCTGTGG - Intergenic
908959384 1:69676998-69677020 ACTTTTAAGTGTAAGAACTAAGG - Intronic
909634928 1:77807080-77807102 CCCATTAAGTATAAGTTCTCTGG - Exonic
910934760 1:92478725-92478747 AGCTTTGACTGTAAGATCTGTGG - Exonic
913659007 1:120990370-120990392 TACTTTAAGGGTAACATCTGGGG + Intergenic
914010371 1:143773495-143773517 TACTTTAAGGGTAACATCTGGGG + Intergenic
914167449 1:145187618-145187640 TACTTTAAGGGTAACATCTGGGG - Intergenic
914648992 1:149682154-149682176 TACTTTAAGGGTAACATCTGGGG + Intergenic
915274911 1:154781830-154781852 CCCCTGAAATGTAAGCTCTGTGG - Intronic
918592125 1:186251875-186251897 CTCCTTAAATGTAAGCTCTGAGG - Intergenic
918620595 1:186600019-186600041 CCCATTTAGTATAATATCTGTGG + Intergenic
918898894 1:190386297-190386319 TCCTTTAAGTCAAAGATATGGGG + Intronic
920782373 1:209006539-209006561 CCCTTGAAATGTCAGATATGAGG - Intergenic
921693112 1:218176176-218176198 CCCTCTATGTCTAAAATCTGTGG - Intergenic
922305199 1:224338424-224338446 CACTTTAAGTTTCAGTTCTGTGG + Intergenic
1063780375 10:9315711-9315733 CCCTATTAGTGAAAGATCAGAGG + Intergenic
1065580637 10:27167750-27167772 CCCTTAAAGTGTCTGTTCTGAGG + Intronic
1065580643 10:27167864-27167886 CCCTTAAAGTGTCTGTTCTGAGG + Intronic
1066585059 10:36923929-36923951 CCCTTTAAGTGTACCATGTTAGG - Intergenic
1066754628 10:38698594-38698616 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
1068412303 10:56672346-56672368 CCCTTTAAGTGCATGTTCTTAGG - Intergenic
1075415469 10:122259197-122259219 CCCCTTGGGTGTAAGATCTGAGG + Intergenic
1075502865 10:122993847-122993869 CCTTTTCAGTGTAATATATGTGG - Exonic
1075565590 10:123501605-123501627 CCCAGTGAGTGTCAGATCTGTGG + Intergenic
1078006217 11:7534555-7534577 CCCTTGAAGGGTAAGTTCTGGGG + Intronic
1079639359 11:22784862-22784884 GCTTTTAACTATAAGATCTGAGG + Intronic
1084984453 11:72855546-72855568 CACTTTAAGTGTAAGTTTAGTGG - Intronic
1085229927 11:74958000-74958022 CCCAGTAAGTGTGAGATCTAAGG - Intronic
1085903135 11:80726227-80726249 CCCTTTAAGTGTACCATGTTGGG + Intergenic
1096700288 12:53378743-53378765 CCCTTTGAAGGTAAGAACTGAGG - Intergenic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1100450234 12:94698920-94698942 CCCTTTATATATAAAATCTGTGG + Intergenic
1107230448 13:38103925-38103947 CCCTTTCAGGGTAGGATCTGTGG - Intergenic
1107780595 13:43898160-43898182 TCCTTTAAGACTCAGATCTGGGG + Intergenic
1108020122 13:46119828-46119850 ACTTTTAAGTGTTAAATCTGAGG - Intergenic
1109830367 13:67778610-67778632 CCCTTTTAGAGTAAGGTGTGGGG - Intergenic
1113954973 13:114095278-114095300 CCCTTTAAGTGTAAACACAGTGG + Intronic
1114317890 14:21524508-21524530 CCCTATAAGTGCAATGTCTGTGG - Exonic
1114535747 14:23421186-23421208 CCCTGGAAGTGTAACACCTGCGG + Intronic
1115187351 14:30705128-30705150 GCAATTAAGTGTAAAATCTGTGG + Intronic
1116397540 14:44464657-44464679 CCCTCTAAATGTATTATCTGGGG + Intergenic
1116911579 14:50471817-50471839 CCCTATAAATGTAAGAAATGTGG + Intronic
1119127074 14:72137426-72137448 CCCTTTACCTGTGAGATCTGAGG - Intronic
1119959468 14:78838106-78838128 CCCTTTAACTCTACTATCTGTGG + Intronic
1122526652 14:102390704-102390726 CACTGTAAGTGTTAGATCTCAGG - Intronic
1123737144 15:23196270-23196292 CCCTTGGAGTGTTTGATCTGCGG - Intergenic
1124288360 15:28424935-28424957 CCCTTGGAGTGTTTGATCTGCGG - Intergenic
1124294864 15:28492379-28492401 CCCTTGGAGTGTTTGATCTGCGG + Intergenic
1125987337 15:44066898-44066920 CCCTTTAAGGAAAAGAACTGAGG - Intronic
1127659818 15:61089959-61089981 ACCTTTAACTATAAGACCTGGGG + Intronic
1129153162 15:73701999-73702021 CCATTAAAATGTAAGTTCTGTGG + Intronic
1129773374 15:78217022-78217044 CCCTTTATCTGTGATATCTGAGG - Intronic
1132350724 15:101138270-101138292 CCCTTTAGGGAAAAGATCTGGGG - Intergenic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1136728057 16:32378253-32378275 CCTTTTAAGGGTAGGGTCTGTGG + Intergenic
1137022860 16:35447359-35447381 CCCTTTAGATGTAAGAAGTGTGG - Intergenic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1139162607 16:64529105-64529127 CCTATTAACTGTGAGATCTGGGG + Intergenic
1140047156 16:71448328-71448350 CCCTTTCAGTGTAAGGAGTGTGG - Exonic
1140047251 16:71449252-71449274 CCCTATCAGTGTAAGATGTGTGG - Exonic
1202998382 16_KI270728v1_random:139501-139523 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
1203129975 16_KI270728v1_random:1675905-1675927 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
1143208997 17:5169359-5169381 CCCTTATAGTGAAAGTTCTGAGG + Intronic
1144594125 17:16552181-16552203 CCCTTTAAATGCAATATATGTGG - Exonic
1144601825 17:16622613-16622635 CCCTATAAGTGTGATGTCTGTGG - Exonic
1144618487 17:16798834-16798856 CCCTTATAGTGAAAGTTCTGAGG + Intronic
1144894219 17:18516859-18516881 CCCTTATAGTGAAAGTTCTGAGG - Intergenic
1145138012 17:20427381-20427403 CCCTTATAGTGAAAGTTCTGAGG + Intergenic
1148657538 17:49298894-49298916 CCCTTTATCTGTGAAATCTGTGG - Exonic
1158567573 18:58568158-58568180 CCCTTAAAGTGTAAGGGCTTTGG - Intronic
1159944660 18:74435334-74435356 CCCTTTAAGTGAAAGCTCACTGG + Exonic
1160214277 18:76913823-76913845 CCCTACAAGTGCAAGCTCTGTGG + Exonic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1160616299 18:80132184-80132206 CCCTTTAAGTATGAAATCTGAGG - Intronic
1161187783 19:2933802-2933824 CCCTTTGAGTGTAAGCATTGTGG - Exonic
1162247456 19:9413936-9413958 CCCTTTGAATGTAAGATATGTGG - Exonic
1162253450 19:9466794-9466816 CCCTATAAATGTAAGGACTGTGG - Exonic
1162253489 19:9467382-9467404 CCCTTTAAGTGTTACAAATGTGG - Exonic
1162260382 19:9528768-9528790 GCCTGTGAGTGTAAGATATGTGG - Exonic
1162265088 19:9566328-9566350 CCCTTTGAATGTAAGGTATGTGG - Exonic
1162614028 19:11781412-11781434 CCCTATAAGTGTAAACTATGTGG + Exonic
1162619793 19:11832982-11833004 CCTTATAAATGTAAGATATGTGG + Exonic
1162629067 19:11911856-11911878 CCTTATAAATGTAAGATATGTGG + Intronic
1162633691 19:11949105-11949127 CCTTATAAATGTAAGATATGTGG + Exonic
1162637321 19:11979892-11979914 CCTTATAAATGTAAGATATGTGG + Intergenic
1162645225 19:12044451-12044473 CCCTATGAGTGTAAGCTATGTGG - Exonic
1162663199 19:12187213-12187235 CCCTTTAAATGTAAGCAATGTGG + Exonic
1162669894 19:12247758-12247780 CCCTTTGAGTGTAAAAAATGTGG - Intronic
1162669934 19:12248262-12248284 CCCTTTAAGTGTAAAGAATGTGG - Intronic
1162686636 19:12391370-12391392 CCTCATAAGTGTAAGATATGTGG - Exonic
1165536280 19:36449116-36449138 CCCTATGAATGTAAGATATGTGG - Exonic
1165543611 19:36514226-36514248 CCTTATGAGTGTAAGGTCTGTGG - Exonic
1165589029 19:36949814-36949836 CCCTTTAAGTGTAATCAGTGTGG + Exonic
1165594086 19:36997291-36997313 CCCTGTAAGTGTAAGGAATGTGG + Intronic
1165643700 19:37414083-37414105 CCCTTTAAGTGTAATCATTGTGG - Exonic
1165911137 19:39228683-39228705 CATTTTGAGCGTAAGATCTGAGG - Intergenic
1166021455 19:40034416-40034438 CCCTTTGAATGTAAGAAATGTGG - Exonic
1166609417 19:44176850-44176872 CCCTATAAATGTGAGATATGTGG + Exonic
1166628771 19:44386608-44386630 CCCTATAAGTGTAAGGCATGTGG - Exonic
1166638469 19:44473070-44473092 CCCTATAAGTGTAAGGCATGTGG + Intergenic
1167231436 19:48286783-48286805 CCCTATAAATGTAAGACATGTGG + Exonic
1167536843 19:50059110-50059132 CCCTATAAGTGTAAGGAATGTGG - Intergenic
1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG + Exonic
1168421792 19:56208856-56208878 CTCTTTCAGTGTAATCTCTGCGG + Exonic
1168531751 19:57135567-57135589 CCCTATCAGTGTAAGACATGTGG - Exonic
1168531755 19:57135651-57135673 CCCTATAAATGTGAGAACTGTGG - Exonic
925231168 2:2235276-2235298 CCCTCTAAGGGGAAGCTCTGAGG - Intronic
925231178 2:2235345-2235367 CCCTCTAAGGGGAAGCTCTGAGG - Intronic
925674185 2:6342847-6342869 CCTTTAAAGTTTTAGATCTGTGG - Intergenic
926945038 2:18178233-18178255 CCCTTTAATTGTCAGAGCTCAGG - Intronic
930731878 2:54735736-54735758 CCCTTTCAATGTAAGAAATGTGG + Intronic
930984472 2:57568310-57568332 TTCTTTAACTGTAAGATATGTGG - Intergenic
933630764 2:84654652-84654674 AACTTTAGGTGCAAGATCTGCGG + Exonic
938544848 2:132318578-132318600 CCCTGTAAGTGTAAGGCATGTGG + Intergenic
941853027 2:170203269-170203291 TCCTTTTAGTGTAAAATCTTTGG + Intronic
941956453 2:171210430-171210452 CCCTTTAAGTGTAATAGCCCTGG + Intronic
944756310 2:202765565-202765587 GCCCTTGAGTGTAAGATCCGGGG - Exonic
946627900 2:221634564-221634586 CTCTTGAAGTATAAGATCTAAGG - Intergenic
947102869 2:226639970-226639992 CTCTTTAAGTCTAATAACTGAGG - Intergenic
1171873707 20:30551312-30551334 CCCTATAAGTGTAAGGCATGTGG + Intergenic
1172738019 20:37143196-37143218 CCCTACATGAGTAAGATCTGTGG + Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1174949875 20:55031709-55031731 TGCTTTAAGAGTAACATCTGGGG + Intergenic
1177585657 21:23091223-23091245 CCCTATAAATGTAAGAAATGTGG - Intergenic
1180306089 22:11126504-11126526 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
1180544608 22:16488687-16488709 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
950641208 3:14349688-14349710 CTCTTTAAGTTTACAATCTGAGG - Intergenic
952176958 3:30874477-30874499 CCATTTATGTGTAAGATTTTGGG + Intronic
953168609 3:40487453-40487475 CCCTTTAAATGTAAGGAATGTGG + Exonic
953173951 3:40532302-40532324 CCCTTTAAGTGTAAGGAGTGTGG + Exonic
953628888 3:44594422-44594444 CCCTATAAGTGTAAGGAGTGTGG + Exonic
954479615 3:50786680-50786702 CCCTTTATCTGTGAAATCTGTGG - Intronic
962371373 3:134823435-134823457 CTCTTAAAGTTTAAGGTCTGGGG + Intronic
964641469 3:158913979-158914001 CACTTTAAGAGTAATATCTGGGG + Intergenic
966489058 3:180505986-180506008 CCCTTCATGTGTAATTTCTGTGG - Intergenic
968091120 3:195898792-195898814 CCCTTTAATTTTAATGTCTGCGG + Intronic
968696883 4:2034987-2035009 TACTTTAAGGGTAACATCTGGGG + Intronic
970017395 4:11527681-11527703 CAGTTTAAGTGTAATATTTGAGG - Intergenic
971911658 4:32802851-32802873 TACTTTAAGGGTAACATCTGTGG - Intergenic
973143617 4:46797980-46798002 CCCTTTGAATTTAAGACCTGGGG - Intronic
973960648 4:56106546-56106568 CCCTTTCAGTGTTAGCTATGTGG + Intergenic
977662709 4:99609388-99609410 CCATTTAAGTTTAAAATCTTAGG + Intronic
978778107 4:112522520-112522542 CCTTTTGAATGTAAGCTCTGTGG - Intergenic
980214604 4:129835387-129835409 CCTTTTAAGTCTGAGATCTGGGG + Intergenic
981071662 4:140546819-140546841 ACATTAAAGTGTAATATCTGAGG + Intronic
986080241 5:4384243-4384265 CCCTTTAAATGTTTGATGTGGGG - Intergenic
986183961 5:5419261-5419283 CACTTTGAGGGTAAGAGCTGAGG + Intergenic
986778095 5:11038051-11038073 CCCTTTAAATGTAACATCTCTGG - Intronic
989404992 5:41050489-41050511 CCTTTTAAGTGGTAGATCAGAGG - Intronic
991864154 5:71042180-71042202 CCTGTTGAGTGTAAAATCTGTGG - Exonic
991974582 5:72173715-72173737 ATCTTTAAGAATAAGATCTGAGG - Intronic
995102203 5:108326017-108326039 CCCTTAAAGTGTAAACTCAGTGG - Intronic
995378805 5:111509629-111509651 CCGTTTAACTGTAAAATCTTTGG + Intronic
997311738 5:132891083-132891105 TCCTTTAACTGTAGGATTTGAGG - Intronic
1002027156 5:176403372-176403394 CCCTTTAAATGCAAGTTCTCTGG - Intronic
1002366061 5:178712211-178712233 CCCTTTAAATGTAATACATGTGG - Exonic
1002387967 5:178884097-178884119 CCCTTTAAATGTAATACATGTGG + Exonic
1002393158 5:178931698-178931720 CCCTATAAGTGTAATGTATGTGG + Exonic
1002554819 5:180028112-180028134 CCTTGTAAGTGAAGGATCTGAGG - Intronic
1004879374 6:19991918-19991940 TCCTTTAAGGGTAAGAGCAGGGG - Intergenic
1007480094 6:42143846-42143868 CGCCTTTGGTGTAAGATCTGGGG - Intergenic
1010775125 6:79876781-79876803 CCTTTTGAGAGTAAGCTCTGAGG + Intergenic
1013309165 6:108877591-108877613 CCTTTTATGTTTAAGCTCTGAGG - Intronic
1014696147 6:124623490-124623512 CCCTACAACTTTAAGATCTGTGG - Intronic
1018440308 6:163806282-163806304 CCCTTGAAGAGTAAGAGCTCTGG + Intergenic
1020519950 7:9173220-9173242 CCCTTAAAGGGTGAGATCTAGGG - Intergenic
1023626697 7:42121903-42121925 CCTTTTAATTTTAAGATCTGGGG - Intronic
1029222648 7:99002682-99002704 CCCTTTCATTTTAAGCTCTGTGG - Intronic
1029288928 7:99486892-99486914 CCTTTTGAGTGTAAGGTCTGTGG + Exonic
1039456043 8:37707538-37707560 CTCTTTAACTGTGAGATCTTGGG - Intergenic
1041560036 8:59206962-59206984 CCCTGTAAGTATCAGTTCTGAGG - Intergenic
1041703482 8:60818331-60818353 CCCTTTAAGTGAGTAATCTGCGG - Intronic
1042945464 8:74149863-74149885 CCCTTTATGTTTAAGATCAAAGG + Intergenic
1053073329 9:35113946-35113968 CCCTTTCACTGTGACATCTGGGG + Intronic
1055006513 9:71513269-71513291 CCTTTTAAGTGTAGGATCCAGGG + Intergenic
1057635269 9:96758929-96758951 CCCTTTCAGTGTAATAAATGTGG - Exonic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1060851518 9:126880606-126880628 CCCTTTGTGTGCAAGTTCTGTGG + Exonic
1061758511 9:132833208-132833230 CCCTTTAAATGCAAGAGCTCTGG - Intronic
1187915121 X:24146851-24146873 TCCTTTAAGTGCAAGATGTCTGG + Intergenic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1191710540 X:64145871-64145893 CCCTATCAGTGTAAGAAATGTGG - Intergenic
1194839849 X:98726701-98726723 CTCTTTAAGTGGAAGAACGGAGG + Intergenic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic
1201185477 Y:11397865-11397887 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic