ID: 1137786379

View in Genome Browser
Species Human (GRCh38)
Location 16:51140774-51140796
Sequence CCATTCAAGTGCAACATCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137786379_1137786382 -7 Left 1137786379 16:51140774-51140796 CCGCAGATGTTGCACTTGAATGG 0: 1
1: 1
2: 3
3: 13
4: 127
Right 1137786382 16:51140790-51140812 TGAATGGCCTCTCTCCGGTATGG 0: 1
1: 0
2: 0
3: 17
4: 92
1137786379_1137786385 5 Left 1137786379 16:51140774-51140796 CCGCAGATGTTGCACTTGAATGG 0: 1
1: 1
2: 3
3: 13
4: 127
Right 1137786385 16:51140802-51140824 CTCCGGTATGGGAACGCAAGTGG 0: 1
1: 0
2: 0
3: 2
4: 21
1137786379_1137786387 15 Left 1137786379 16:51140774-51140796 CCGCAGATGTTGCACTTGAATGG 0: 1
1: 1
2: 3
3: 13
4: 127
Right 1137786387 16:51140812-51140834 GGAACGCAAGTGGATCTGCAAGG 0: 1
1: 1
2: 2
3: 8
4: 72
1137786379_1137786383 -6 Left 1137786379 16:51140774-51140796 CCGCAGATGTTGCACTTGAATGG 0: 1
1: 1
2: 3
3: 13
4: 127
Right 1137786383 16:51140791-51140813 GAATGGCCTCTCTCCGGTATGGG 0: 1
1: 0
2: 1
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137786379 Original CRISPR CCATTCAAGTGCAACATCTG CGG (reversed) Exonic
901081842 1:6588154-6588176 CCCTTCCAGTGCCACCTCTGTGG + Exonic
901318675 1:8325644-8325666 CCATCCAAGTGCAAAATATATGG + Intronic
909312885 1:74175602-74175624 CCAGTAGAGTGCAAAATCTGGGG - Intronic
914354804 1:146875336-146875358 ACATTTATGTGCAACATCTCAGG + Intergenic
916315023 1:163439332-163439354 CCAGGCAAGGGCAACACCTGGGG - Intergenic
918958116 1:191236937-191236959 CCATTCAGGTAGACCATCTGGGG - Intergenic
919351643 1:196463303-196463325 TCATTCAAGTTCAACATCAAAGG - Intronic
924631162 1:245742313-245742335 CAATTAAAATCCAACATCTGGGG - Intergenic
1066418620 10:35243882-35243904 CCAATCAAGTGCATCATTTCAGG - Intergenic
1068291307 10:55004706-55004728 TTATTCAAGTGCTACAGCTGAGG - Intronic
1069206596 10:65696616-65696638 CCACTCAAGTGTTATATCTGTGG - Intergenic
1071280000 10:84092821-84092843 CCTTGAAAGTGCCACATCTGAGG + Intergenic
1071370202 10:84943592-84943614 TTATTCAAGTGCAACATTTGAGG - Intergenic
1073153511 10:101328279-101328301 CCATGCAAGTCCAAAATCAGTGG - Intergenic
1074780835 10:116800782-116800804 CCATTCAAATGCAAACTCTGAGG + Intergenic
1074879670 10:117645897-117645919 CCAGGCAAGTGCCAGATCTGTGG - Intergenic
1080094161 11:28384540-28384562 CAAGGCAAGTGCATCATCTGAGG - Intergenic
1086889704 11:92243323-92243345 ACATTCAATTGAATCATCTGTGG - Intergenic
1087777309 11:102268363-102268385 CTATTCAACTGCAACTTCTAAGG + Intergenic
1088170552 11:106991465-106991487 CAATTCAACTGGAAAATCTGGGG - Intronic
1089044957 11:115492767-115492789 CAATTCCAGTCTAACATCTGAGG - Intronic
1095094203 12:38136766-38136788 CCAGGCAAGTGGATCATCTGAGG + Intergenic
1095994999 12:48074415-48074437 GGATCCAAATGCAACATCTGGGG + Exonic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1099841008 12:87967125-87967147 CCATTGAAGTTCAAAATCTATGG + Intergenic
1100237657 12:92677161-92677183 ACATTCAAGTGAAATAACTGGGG + Intergenic
1102888030 12:116536266-116536288 CCATTCTAGGGCAACATCTGTGG + Intergenic
1106006206 13:25772364-25772386 CCATTGAAGTTTAACATCAGGGG + Intronic
1106783050 13:33079040-33079062 CCATTCCATGGCATCATCTGAGG + Intergenic
1106785251 13:33101045-33101067 GCACTTTAGTGCAACATCTGGGG - Intergenic
1109265998 13:60201064-60201086 CCATTCATTTTTAACATCTGAGG - Intergenic
1114692885 14:24601251-24601273 CCACTCAAGTGCACCATCTGGGG - Intergenic
1115340239 14:32286057-32286079 CCAATGAAGTGCAACAGCAGAGG + Intergenic
1118296722 14:64576919-64576941 GGATTCAGGTGCAACAGCTGGGG - Intronic
1127404504 15:58627787-58627809 GTATGCAAGAGCAACATCTGGGG - Exonic
1127473714 15:59312983-59313005 CCATTGCACTGCAACATCTTGGG + Intronic
1129912528 15:79240296-79240318 CCACTCAATTCCAACATCTGTGG + Intergenic
1130069017 15:80630862-80630884 CCATTAAATTACAACTTCTGGGG - Intergenic
1132897192 16:2234709-2234731 CCGTTCAAGTGCTACAAGTGCGG + Exonic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1135794980 16:25433066-25433088 CCATCCAAGTGCAGCATCCTGGG + Intergenic
1135944227 16:26851469-26851491 ACATTCAAGAGCAAAATCTATGG + Intergenic
1137705402 16:50532274-50532296 ACAGTCAAGTCCAACATCAGTGG + Intergenic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1139979216 16:70840196-70840218 ACATTTATGTGCAACATCTCAGG - Exonic
1140686629 16:77439947-77439969 GCATTCAAGTGCAAGTACTGTGG - Intergenic
1140794553 16:78424947-78424969 CCTTTCAAGTGAATCATCTGGGG + Exonic
1142918698 17:3165065-3165087 CAATTCCAGTGCAACATCTCAGG - Intergenic
1144535613 17:16087108-16087130 CCACCCACGTGGAACATCTGTGG + Intronic
1146532346 17:33619419-33619441 AGGTGCAAGTGCAACATCTGAGG + Intronic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1155685328 18:28541432-28541454 CCATTCCAGTGCAGTGTCTGGGG - Intergenic
1156682540 18:39608534-39608556 CCATTCAATTACAACAGGTGGGG + Intergenic
1158123548 18:54077396-54077418 CAATTCCAATGCAACATCAGAGG - Intergenic
1158427860 18:57354319-57354341 CCATTAAAGTGCAGCGGCTGGGG - Intronic
1158981942 18:62771256-62771278 CCATCCATGTGGATCATCTGAGG + Intronic
1160214277 18:76913823-76913845 CCCTACAAGTGCAAGCTCTGTGG + Exonic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1161345488 19:3767049-3767071 CCATCCCAGTGGCACATCTGAGG - Intronic
1166623596 19:44328583-44328605 CCATACAAATGCAATATATGCGG - Exonic
1167845122 19:52156508-52156530 CCATACAAATGCAACATATGTGG - Exonic
1167879231 19:52441824-52441846 CCTTACAAATGCAACATATGTGG + Intronic
1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG + Exonic
925910443 2:8570272-8570294 CTATTCAAATGCCGCATCTGGGG - Intergenic
925989773 2:9245298-9245320 CCATTCAAATGCAACAGCCACGG - Intronic
926183420 2:10666843-10666865 CCATTCAAGTGTTACCTCTGGGG + Intronic
927037828 2:19199085-19199107 CCACTCATGTGAACCATCTGTGG + Intergenic
935034499 2:99355843-99355865 CCAGGCAAGTGGATCATCTGAGG - Intronic
935432718 2:102993604-102993626 CCATTCTAGTTAAATATCTGGGG + Intergenic
936363075 2:111824718-111824740 CCATTTAATTGGAACATTTGAGG - Intronic
937147340 2:119659043-119659065 CAATTCCAGTCCAACACCTGGGG + Intronic
938240222 2:129737681-129737703 CCATGCAAGTGCCACATCCCTGG - Intergenic
943757182 2:191569012-191569034 CCTTTAAAGTGGACCATCTGTGG + Intergenic
945260290 2:207836812-207836834 CAATCCAAGTGAAATATCTGAGG - Intronic
945688817 2:213007427-213007449 CCACTGGAATGCAACATCTGTGG - Exonic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
946782510 2:223205775-223205797 GCACTCCAGTGCATCATCTGGGG + Intergenic
947481341 2:230502977-230502999 CCATTCAAATGCAACTTTTCAGG - Intronic
947787546 2:232837151-232837173 CCAAACAAGTGCAACAGATGTGG - Intronic
1170705725 20:18743173-18743195 CCATTCGAGTGAGACATCAGGGG + Intronic
1171093730 20:22311436-22311458 TCATTAAAGGGCAATATCTGGGG - Intergenic
1173923932 20:46766565-46766587 CCATTCAAGAGCAATATAAGAGG - Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175504031 20:59469522-59469544 CCATGCAAGAGTAACAGCTGGGG - Intergenic
1181079826 22:20406444-20406466 CCCTTCAAGTGCAACGAGTGCGG + Exonic
1181235677 22:21446489-21446511 CCCTTCCCCTGCAACATCTGTGG + Exonic
1182270310 22:29149143-29149165 CCATTATGTTGCAACATCTGCGG - Intronic
953573768 3:44096166-44096188 CCATGCCAGTGAAAAATCTGTGG - Intergenic
955624749 3:60906344-60906366 CCATTCAAATTCAACATCACAGG - Intronic
958801433 3:98760738-98760760 ACATTCAAGTGCAACTTCTTGGG - Intronic
958870259 3:99550303-99550325 TAATTCAAAGGCAACATCTGTGG + Intergenic
962781414 3:138721395-138721417 CCAGACAAGTGGAACACCTGAGG - Intronic
963086916 3:141445497-141445519 CCATACCAGTGCAAGACCTGCGG + Exonic
963525730 3:146411599-146411621 TCACTCAAGTACAACATTTGGGG - Intronic
966081476 3:176008400-176008422 CCATTAAAGTGAACAATCTGAGG - Intergenic
966748285 3:183298985-183299007 CCATGCAAGAGGAACAGCTGTGG + Intronic
966985352 3:185175104-185175126 CCCATCAAGTTCATCATCTGTGG - Intergenic
971800019 4:31277144-31277166 CCATTCAAATTCAACATCACAGG - Intergenic
978392004 4:108236766-108236788 CCATTCCACTGCAGCTTCTGTGG + Intergenic
978972071 4:114820913-114820935 CCAGGCAAGTGGATCATCTGAGG + Intergenic
981071662 4:140546819-140546841 ACATTAAAGTGTAATATCTGAGG + Intronic
981079130 4:140621617-140621639 CCTTTGAAGGGGAACATCTGTGG + Exonic
981189372 4:141842713-141842735 TTATTCAAGTGCAACACTTGGGG - Intergenic
986100314 5:4602471-4602493 CCACACAAGTCCAACTTCTGCGG - Intergenic
986618269 5:9642829-9642851 TGATTCAACTGCAGCATCTGTGG - Intronic
989495084 5:42102489-42102511 CCATGCAAGTCCAAAATCTAAGG - Intergenic
991703428 5:69336069-69336091 CCATTCTCCTGCAACATCAGGGG + Intergenic
1002131075 5:177082067-177082089 CCATCCAAGAGCAACATCGTTGG + Intergenic
1002286406 5:178165481-178165503 CCAATCAGATGCAACAGCTGAGG + Intergenic
1005684963 6:28245441-28245463 CCATACCAGTGCAATATGTGTGG - Exonic
1007093279 6:39197757-39197779 CCATTCAAGATCGATATCTGAGG - Intronic
1010538639 6:77063494-77063516 CCACTCATGTGCAGCACCTGTGG - Intergenic
1011630899 6:89323272-89323294 TCATTCAAGTGCAAAGTATGAGG + Intergenic
1016236731 6:141877215-141877237 TTATTCAAGTGCAAAATGTGAGG + Intergenic
1016782814 6:147978528-147978550 GTATTCAAGTGGTACATCTGAGG + Intergenic
1022957046 7:35390538-35390560 CCAATCCATGGCAACATCTGAGG + Intergenic
1024113141 7:46166848-46166870 CCATTGAAGTGTATCTTCTGAGG + Intergenic
1024531917 7:50400532-50400554 CCTTTTGAGTGCAACATGTGCGG + Exonic
1025199353 7:56952177-56952199 CCATTTAAGTGCAACTCCAGGGG - Intergenic
1025672595 7:63624756-63624778 CCATTTAAGTGCAACTCCAGGGG + Intergenic
1027703391 7:81497568-81497590 CCATTCTAGTGGAATATCTGGGG + Intergenic
1029912190 7:104164842-104164864 CCATGCAATTGCAAATTCTGGGG + Intronic
1030389035 7:108902690-108902712 CCATTGAAGTGCAAAATCTCTGG + Intergenic
1033448256 7:141440376-141440398 CCATCCAAGTGGAACTTCTGGGG + Intronic
1035909069 8:3545627-3545649 CAATTCAGGTGCATCATCAGCGG + Intronic
1041967337 8:63694481-63694503 CCATTCCAGTGCCTCATTTGGGG - Intergenic
1042187667 8:66153296-66153318 CCAATTAGGTGCAGCATCTGGGG - Intronic
1044592905 8:93931149-93931171 CCATTCATTTGAAACATCTAGGG + Intergenic
1045390120 8:101707012-101707034 GCATTCCAGAGCCACATCTGTGG + Intronic
1047176206 8:122542865-122542887 CCACCCAATTGCATCATCTGTGG + Intergenic
1057359478 9:94360191-94360213 CCATTCTCCTGCAACATCAGGGG + Intergenic
1057648284 9:96897401-96897423 CCATTCTCCTGCAACATCAGGGG - Intergenic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1187271149 X:17780914-17780936 CCAATCATGTCCAATATCTGTGG - Intergenic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1190363106 X:49667342-49667364 GCGTTCAAGTACAACATCTGTGG - Intergenic
1190633265 X:52410143-52410165 AGATTCAGGTGCAAAATCTGGGG + Intergenic
1191089021 X:56600651-56600673 TCATTCAAGTGCAAAGTGTGAGG - Intergenic
1194473420 X:94326844-94326866 TCACTCAGGTGCAAAATCTGCGG + Intergenic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic
1197222606 X:123928167-123928189 CCAATCAAACGCAACATCTTGGG - Intergenic
1198135758 X:133748864-133748886 CCATTCACTTCCAACCTCTGGGG + Intronic
1202139331 Y:21704869-21704891 CCATTCAAGTCCTACATTTTTGG + Intergenic