ID: 1137787992

View in Genome Browser
Species Human (GRCh38)
Location 16:51152643-51152665
Sequence TGGGCACCCCGCCCTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137787973_1137787992 20 Left 1137787973 16:51152600-51152622 CCGGGCGGACCCGGCACTGGACT No data
Right 1137787992 16:51152643-51152665 TGGGCACCCCGCCCTGGGGAGGG No data
1137787972_1137787992 21 Left 1137787972 16:51152599-51152621 CCCGGGCGGACCCGGCACTGGAC No data
Right 1137787992 16:51152643-51152665 TGGGCACCCCGCCCTGGGGAGGG No data
1137787982_1137787992 -6 Left 1137787982 16:51152626-51152648 CCAGTCCCTGGGACCCCTGGGCA No data
Right 1137787992 16:51152643-51152665 TGGGCACCCCGCCCTGGGGAGGG No data
1137787977_1137787992 10 Left 1137787977 16:51152610-51152632 CCGGCACTGGACTGGGCCAGTCC No data
Right 1137787992 16:51152643-51152665 TGGGCACCCCGCCCTGGGGAGGG No data
1137787976_1137787992 11 Left 1137787976 16:51152609-51152631 CCCGGCACTGGACTGGGCCAGTC No data
Right 1137787992 16:51152643-51152665 TGGGCACCCCGCCCTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137787992 Original CRISPR TGGGCACCCCGCCCTGGGGA GGG Intergenic
No off target data available for this crispr