ID: 1137794025

View in Genome Browser
Species Human (GRCh38)
Location 16:51199583-51199605
Sequence GCTCCCTCTTCCCACACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137794025_1137794027 15 Left 1137794025 16:51199583-51199605 CCTTTAGTGTGGGAAGAGGGAGC No data
Right 1137794027 16:51199621-51199643 AGCACTAGGTGAAGTAGTTGAGG No data
1137794025_1137794026 1 Left 1137794025 16:51199583-51199605 CCTTTAGTGTGGGAAGAGGGAGC No data
Right 1137794026 16:51199607-51199629 TACTCTTTCAGTTGAGCACTAGG No data
1137794025_1137794029 17 Left 1137794025 16:51199583-51199605 CCTTTAGTGTGGGAAGAGGGAGC No data
Right 1137794029 16:51199623-51199645 CACTAGGTGAAGTAGTTGAGGGG No data
1137794025_1137794028 16 Left 1137794025 16:51199583-51199605 CCTTTAGTGTGGGAAGAGGGAGC No data
Right 1137794028 16:51199622-51199644 GCACTAGGTGAAGTAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137794025 Original CRISPR GCTCCCTCTTCCCACACTAA AGG (reversed) Intergenic
No off target data available for this crispr