ID: 1137794286

View in Genome Browser
Species Human (GRCh38)
Location 16:51202172-51202194
Sequence ATCATCAGTGATGGGCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137794286_1137794290 -6 Left 1137794286 16:51202172-51202194 CCTCCTTGCCCATCACTGATGAT No data
Right 1137794290 16:51202189-51202211 GATGATCTATCCTGCTTACACGG No data
1137794286_1137794291 -5 Left 1137794286 16:51202172-51202194 CCTCCTTGCCCATCACTGATGAT No data
Right 1137794291 16:51202190-51202212 ATGATCTATCCTGCTTACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137794286 Original CRISPR ATCATCAGTGATGGGCAAGG AGG (reversed) Intergenic
No off target data available for this crispr