ID: 1137795153

View in Genome Browser
Species Human (GRCh38)
Location 16:51211047-51211069
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137795146_1137795153 29 Left 1137795146 16:51210995-51211017 CCAAAATATTTCTAAATCATAGA No data
Right 1137795153 16:51211047-51211069 CTGCTCTGGTAGGGGATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137795153 Original CRISPR CTGCTCTGGTAGGGGATAAA AGG Intergenic
No off target data available for this crispr