ID: 1137801422

View in Genome Browser
Species Human (GRCh38)
Location 16:51265652-51265674
Sequence CCTTATAAGAGAAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137801422_1137801427 -1 Left 1137801422 16:51265652-51265674 CCCTCCACCTTTCTCTTATAAGG No data
Right 1137801427 16:51265674-51265696 GACAGTTGTGATTGCATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137801422 Original CRISPR CCTTATAAGAGAAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr