ID: 1137804266

View in Genome Browser
Species Human (GRCh38)
Location 16:51288629-51288651
Sequence CTGGCTGGAAGGCTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137804266_1137804273 4 Left 1137804266 16:51288629-51288651 CCTTCCACCAGCCTTCCAGCCAG No data
Right 1137804273 16:51288656-51288678 CATCCCTTTGTTCATGCCCTGGG No data
1137804266_1137804274 5 Left 1137804266 16:51288629-51288651 CCTTCCACCAGCCTTCCAGCCAG No data
Right 1137804274 16:51288657-51288679 ATCCCTTTGTTCATGCCCTGGGG No data
1137804266_1137804272 3 Left 1137804266 16:51288629-51288651 CCTTCCACCAGCCTTCCAGCCAG No data
Right 1137804272 16:51288655-51288677 GCATCCCTTTGTTCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137804266 Original CRISPR CTGGCTGGAAGGCTGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr