ID: 1137806536

View in Genome Browser
Species Human (GRCh38)
Location 16:51311577-51311599
Sequence CCATTGGCAAGGAACTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137806526_1137806536 18 Left 1137806526 16:51311536-51311558 CCTCTCTGGCTCTTATGGTGTGC No data
Right 1137806536 16:51311577-51311599 CCATTGGCAAGGAACTGAGGTGG No data
1137806531_1137806536 -8 Left 1137806531 16:51311562-51311584 CCCTAAAGGAGAGGGCCATTGGC No data
Right 1137806536 16:51311577-51311599 CCATTGGCAAGGAACTGAGGTGG No data
1137806525_1137806536 19 Left 1137806525 16:51311535-51311557 CCCTCTCTGGCTCTTATGGTGTG No data
Right 1137806536 16:51311577-51311599 CCATTGGCAAGGAACTGAGGTGG No data
1137806524_1137806536 20 Left 1137806524 16:51311534-51311556 CCCCTCTCTGGCTCTTATGGTGT No data
Right 1137806536 16:51311577-51311599 CCATTGGCAAGGAACTGAGGTGG No data
1137806532_1137806536 -9 Left 1137806532 16:51311563-51311585 CCTAAAGGAGAGGGCCATTGGCA No data
Right 1137806536 16:51311577-51311599 CCATTGGCAAGGAACTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137806536 Original CRISPR CCATTGGCAAGGAACTGAGG TGG Intergenic
No off target data available for this crispr