ID: 1137809152

View in Genome Browser
Species Human (GRCh38)
Location 16:51336223-51336245
Sequence TCCAAGCCTCCGGCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137809152_1137809164 27 Left 1137809152 16:51336223-51336245 CCCACCCCAGCCGGAGGCTTGGA No data
Right 1137809164 16:51336273-51336295 TTGCAGATCCTTCAAGCCAGTGG No data
1137809152_1137809158 3 Left 1137809152 16:51336223-51336245 CCCACCCCAGCCGGAGGCTTGGA No data
Right 1137809158 16:51336249-51336271 TCATGCCAGCACCTCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137809152 Original CRISPR TCCAAGCCTCCGGCTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr