ID: 1137811089

View in Genome Browser
Species Human (GRCh38)
Location 16:51353148-51353170
Sequence CCACAAGCAAGAAGGGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137811089_1137811094 6 Left 1137811089 16:51353148-51353170 CCCATTGCCCTTCTTGCTTGTGG No data
Right 1137811094 16:51353177-51353199 GCCAAGTTCATGCAGCATTGTGG No data
1137811089_1137811096 13 Left 1137811089 16:51353148-51353170 CCCATTGCCCTTCTTGCTTGTGG No data
Right 1137811096 16:51353184-51353206 TCATGCAGCATTGTGGTCTAAGG No data
1137811089_1137811097 18 Left 1137811089 16:51353148-51353170 CCCATTGCCCTTCTTGCTTGTGG No data
Right 1137811097 16:51353189-51353211 CAGCATTGTGGTCTAAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137811089 Original CRISPR CCACAAGCAAGAAGGGCAAT GGG (reversed) Intergenic
No off target data available for this crispr