ID: 1137811766

View in Genome Browser
Species Human (GRCh38)
Location 16:51359363-51359385
Sequence GCTGAATTGTGGCCATAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137811752_1137811766 30 Left 1137811752 16:51359310-51359332 CCCGACAGCTCTGAGACCACTGC No data
Right 1137811766 16:51359363-51359385 GCTGAATTGTGGCCATAACCTGG No data
1137811758_1137811766 14 Left 1137811758 16:51359326-51359348 CCACTGCGGTGGCTGGGCACAAT No data
Right 1137811766 16:51359363-51359385 GCTGAATTGTGGCCATAACCTGG No data
1137811753_1137811766 29 Left 1137811753 16:51359311-51359333 CCGACAGCTCTGAGACCACTGCG No data
Right 1137811766 16:51359363-51359385 GCTGAATTGTGGCCATAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137811766 Original CRISPR GCTGAATTGTGGCCATAACC TGG Intergenic
No off target data available for this crispr