ID: 1137815155

View in Genome Browser
Species Human (GRCh38)
Location 16:51391866-51391888
Sequence ACCTGCCGGATGGCAGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137815155_1137815162 -1 Left 1137815155 16:51391866-51391888 CCCAGTCCTGCCATCCGGCAGGT No data
Right 1137815162 16:51391888-51391910 TCAAACTAGCAAGATATGGCGGG No data
1137815155_1137815161 -2 Left 1137815155 16:51391866-51391888 CCCAGTCCTGCCATCCGGCAGGT No data
Right 1137815161 16:51391887-51391909 GTCAAACTAGCAAGATATGGCGG No data
1137815155_1137815160 -5 Left 1137815155 16:51391866-51391888 CCCAGTCCTGCCATCCGGCAGGT No data
Right 1137815160 16:51391884-51391906 CAGGTCAAACTAGCAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137815155 Original CRISPR ACCTGCCGGATGGCAGGACT GGG (reversed) Intergenic
No off target data available for this crispr