ID: 1137821046

View in Genome Browser
Species Human (GRCh38)
Location 16:51446267-51446289
Sequence ACCCTGGTCCTGTAATCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137821046_1137821049 25 Left 1137821046 16:51446267-51446289 CCTCTAGATTACAGGACCAGGGT No data
Right 1137821049 16:51446315-51446337 GTTTGACCCTTACATGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137821046 Original CRISPR ACCCTGGTCCTGTAATCTAG AGG (reversed) Intergenic
No off target data available for this crispr