ID: 1137823552

View in Genome Browser
Species Human (GRCh38)
Location 16:51468288-51468310
Sequence TAGGAGAAGCAAGAAGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137823552_1137823558 22 Left 1137823552 16:51468288-51468310 CCAAACTCTTCTTGCTTCTCCTA No data
Right 1137823558 16:51468333-51468355 AACTTTTCAGTGGCATATTCTGG No data
1137823552_1137823555 12 Left 1137823552 16:51468288-51468310 CCAAACTCTTCTTGCTTCTCCTA No data
Right 1137823555 16:51468323-51468345 GAGCTGCCCAAACTTTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137823552 Original CRISPR TAGGAGAAGCAAGAAGAGTT TGG (reversed) Intergenic
No off target data available for this crispr