ID: 1137824181

View in Genome Browser
Species Human (GRCh38)
Location 16:51475630-51475652
Sequence AAGTTTTAGTCAGGGCAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137824181_1137824185 22 Left 1137824181 16:51475630-51475652 CCTAATTGCCCTGACTAAAACTT No data
Right 1137824185 16:51475675-51475697 TGAGAGTAGATTCCCTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137824181 Original CRISPR AAGTTTTAGTCAGGGCAATT AGG (reversed) Intergenic