ID: 1137824181 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:51475630-51475652 |
| Sequence | AAGTTTTAGTCAGGGCAATT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1137824181_1137824185 | 22 | Left | 1137824181 | 16:51475630-51475652 | CCTAATTGCCCTGACTAAAACTT | No data | ||
| Right | 1137824185 | 16:51475675-51475697 | TGAGAGTAGATTCCCTGTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1137824181 | Original CRISPR | AAGTTTTAGTCAGGGCAATT AGG (reversed) | Intergenic | ||