ID: 1137824184

View in Genome Browser
Species Human (GRCh38)
Location 16:51475653-51475675
Sequence ACTTCTATTCAACGTTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137824184_1137824188 12 Left 1137824184 16:51475653-51475675 CCAGTACAACGTTGAATAGAAGT No data
Right 1137824188 16:51475688-51475710 CCTGTACTGGTGCTGATTTTAGG No data
1137824184_1137824189 13 Left 1137824184 16:51475653-51475675 CCAGTACAACGTTGAATAGAAGT No data
Right 1137824189 16:51475689-51475711 CTGTACTGGTGCTGATTTTAGGG No data
1137824184_1137824185 -1 Left 1137824184 16:51475653-51475675 CCAGTACAACGTTGAATAGAAGT No data
Right 1137824185 16:51475675-51475697 TGAGAGTAGATTCCCTGTACTGG No data
1137824184_1137824190 14 Left 1137824184 16:51475653-51475675 CCAGTACAACGTTGAATAGAAGT No data
Right 1137824190 16:51475690-51475712 TGTACTGGTGCTGATTTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137824184 Original CRISPR ACTTCTATTCAACGTTGTAC TGG (reversed) Intergenic