ID: 1137824185

View in Genome Browser
Species Human (GRCh38)
Location 16:51475675-51475697
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137824184_1137824185 -1 Left 1137824184 16:51475653-51475675 CCAGTACAACGTTGAATAGAAGT No data
Right 1137824185 16:51475675-51475697 TGAGAGTAGATTCCCTGTACTGG No data
1137824183_1137824185 13 Left 1137824183 16:51475639-51475661 CCTGACTAAAACTTCCAGTACAA No data
Right 1137824185 16:51475675-51475697 TGAGAGTAGATTCCCTGTACTGG No data
1137824182_1137824185 14 Left 1137824182 16:51475638-51475660 CCCTGACTAAAACTTCCAGTACA No data
Right 1137824185 16:51475675-51475697 TGAGAGTAGATTCCCTGTACTGG No data
1137824181_1137824185 22 Left 1137824181 16:51475630-51475652 CCTAATTGCCCTGACTAAAACTT No data
Right 1137824185 16:51475675-51475697 TGAGAGTAGATTCCCTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137824185 Original CRISPR TGAGAGTAGATTCCCTGTAC TGG Intergenic