ID: 1137824189

View in Genome Browser
Species Human (GRCh38)
Location 16:51475689-51475711
Sequence CTGTACTGGTGCTGATTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137824182_1137824189 28 Left 1137824182 16:51475638-51475660 CCCTGACTAAAACTTCCAGTACA No data
Right 1137824189 16:51475689-51475711 CTGTACTGGTGCTGATTTTAGGG No data
1137824183_1137824189 27 Left 1137824183 16:51475639-51475661 CCTGACTAAAACTTCCAGTACAA No data
Right 1137824189 16:51475689-51475711 CTGTACTGGTGCTGATTTTAGGG No data
1137824184_1137824189 13 Left 1137824184 16:51475653-51475675 CCAGTACAACGTTGAATAGAAGT No data
Right 1137824189 16:51475689-51475711 CTGTACTGGTGCTGATTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137824189 Original CRISPR CTGTACTGGTGCTGATTTTA GGG Intergenic