ID: 1137826959

View in Genome Browser
Species Human (GRCh38)
Location 16:51506397-51506419
Sequence CAGTGTGAAGAAAGGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137826959_1137826967 8 Left 1137826959 16:51506397-51506419 CCTTCCATCCTTTCTTCACACTG No data
Right 1137826967 16:51506428-51506450 CCCATGATGCTTTGTGTGGGAGG No data
1137826959_1137826970 10 Left 1137826959 16:51506397-51506419 CCTTCCATCCTTTCTTCACACTG No data
Right 1137826970 16:51506430-51506452 CATGATGCTTTGTGTGGGAGGGG No data
1137826959_1137826963 4 Left 1137826959 16:51506397-51506419 CCTTCCATCCTTTCTTCACACTG No data
Right 1137826963 16:51506424-51506446 GTGCCCCATGATGCTTTGTGTGG No data
1137826959_1137826969 9 Left 1137826959 16:51506397-51506419 CCTTCCATCCTTTCTTCACACTG No data
Right 1137826969 16:51506429-51506451 CCATGATGCTTTGTGTGGGAGGG No data
1137826959_1137826964 5 Left 1137826959 16:51506397-51506419 CCTTCCATCCTTTCTTCACACTG No data
Right 1137826964 16:51506425-51506447 TGCCCCATGATGCTTTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137826959 Original CRISPR CAGTGTGAAGAAAGGATGGA AGG (reversed) Intergenic
No off target data available for this crispr