ID: 1137828727

View in Genome Browser
Species Human (GRCh38)
Location 16:51523823-51523845
Sequence CATTGCTACCCATGTCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137828727_1137828733 5 Left 1137828727 16:51523823-51523845 CCCAACAGACATGGGTAGCAATG No data
Right 1137828733 16:51523851-51523873 TGCAGGCAGGTCATGGAGGCTGG No data
1137828727_1137828732 1 Left 1137828727 16:51523823-51523845 CCCAACAGACATGGGTAGCAATG No data
Right 1137828732 16:51523847-51523869 TATCTGCAGGCAGGTCATGGAGG No data
1137828727_1137828736 24 Left 1137828727 16:51523823-51523845 CCCAACAGACATGGGTAGCAATG No data
Right 1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG No data
1137828727_1137828735 17 Left 1137828727 16:51523823-51523845 CCCAACAGACATGGGTAGCAATG No data
Right 1137828735 16:51523863-51523885 ATGGAGGCTGGATCAGGAGCAGG No data
1137828727_1137828734 11 Left 1137828727 16:51523823-51523845 CCCAACAGACATGGGTAGCAATG No data
Right 1137828734 16:51523857-51523879 CAGGTCATGGAGGCTGGATCAGG No data
1137828727_1137828730 -8 Left 1137828727 16:51523823-51523845 CCCAACAGACATGGGTAGCAATG No data
Right 1137828730 16:51523838-51523860 TAGCAATGCTATCTGCAGGCAGG No data
1137828727_1137828731 -2 Left 1137828727 16:51523823-51523845 CCCAACAGACATGGGTAGCAATG No data
Right 1137828731 16:51523844-51523866 TGCTATCTGCAGGCAGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137828727 Original CRISPR CATTGCTACCCATGTCTGTT GGG (reversed) Intergenic
No off target data available for this crispr